Rh3AG226700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
OG0019403
Physical Location & Seq
Reverse (-)
23380177 .. 23383347
3171 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG226700.1

Sequence Viewer

Length: 189 bp
ATGGTACAATACTGTCAGAATGCTTTTACTGGATCTACGAGGAAGCGATCAACTGGACAGCTGGACTGCAATATTATATGCATGCATGGTCGCAAAGAATTAACATTGCGTGGAGGGTCAAGGACTCAAGGAGAAGCAAAAGAAAGAGTAGCGATGGAAAAGATTGGGATGAGAAAGGGAGAGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.98

Weight (kDa)

9.94

Isoelectric Point (pI)

36.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 40
AfaI GTAC 1 cut(s) 6
AluBI AGCT 1 cut(s) 61
AluI AGCT 1 cut(s) 61
AlwI GGATC 1 cut(s) 40
BccI CCATC 1 cut(s) 148
BpuEI CTTGAG 1 cut(s) 111
Bse1I ACTGG 2 cut(s) 34, 58
Bse3DI GCAATG 1 cut(s) 104
BseGI GGATG 1 cut(s) 174
BseMI GCAATG 1 cut(s) 104
BseNI ACTGG 2 cut(s) 34, 58
BsmI GAATGC 1 cut(s) 25
Bsp143I GATC 2 cut(s) 32, 47
BspPI GGATC 1 cut(s) 40
BsrDI GCAATG 1 cut(s) 104
BsrI ACTGG 2 cut(s) 34, 58
BssMI GATC 2 cut(s) 32, 47
Bst4CI ACNGT 1 cut(s) 14
BstC8I GCNNGC 1 cut(s) 83
BstF5I GGATG 1 cut(s) 174
BstKTI GATC 2 cut(s) 35, 50
BstMBI GATC 2 cut(s) 32, 47
BstNSI RCATGY 1 cut(s) 85
BstX2I RGATCY 1 cut(s) 32
BstYI RGATCY 1 cut(s) 32
BtgZI GCGATG 1 cut(s) 167
BtsCI GGATG 1 cut(s) 174
Cac8I GCNNGC 1 cut(s) 83
Csp6I GTAC 1 cut(s) 5
CviAII CATG 2 cut(s) 82, 86
CviJI RGCY 1 cut(s) 61
CviKI_1 RGCY 1 cut(s) 61
CviQI GTAC 1 cut(s) 5
DpnI GATC 2 cut(s) 34, 49
DpnII GATC 2 cut(s) 32, 47
EcoT22I ATGCAT 2 cut(s) 83, 87
FaeI CATG 2 cut(s) 85, 89
FaiI YATR 4 cut(s) 77, 79, 83, 87
FatI CATG 2 cut(s) 81, 85
FokI GGATG 1 cut(s) 181
Hin1II CATG 2 cut(s) 85, 89
HinfI GANTC 1 cut(s) 124
Hpy188I TCNGA 1 cut(s) 18
HpyCH4III ACNGT 1 cut(s) 14
HpyCH4V TGCA 3 cut(s) 69, 81, 85
Hsp92II CATG 2 cut(s) 85, 89
Kzo9I GATC 2 cut(s) 32, 47
LpnPI CCDG 3 cut(s) 15, 39, 47
MalI GATC 2 cut(s) 34, 49
MboI GATC 2 cut(s) 32, 47
MflI RGATCY 1 cut(s) 32
MluCI AATT 1 cut(s) 98
MlyI GAGTC 1 cut(s) 118
MnlI CCTC 2 cut(s) 33, 107
Mph1103I ATGCAT 2 cut(s) 83, 87
MseI TTAA 1 cut(s) 101
MspA1I CMGCKG 1 cut(s) 61
Mva1269I GAATGC 1 cut(s) 25
NdeII GATC 2 cut(s) 32, 47
NlaIII CATG 2 cut(s) 85, 89
NsiI ATGCAT 2 cut(s) 83, 87
NspI RCATGY 1 cut(s) 85
PaeI GCATGC 1 cut(s) 85
PctI GAATGC 1 cut(s) 25
PleI GAGTC 1 cut(s) 118
PpsI GAGTC 1 cut(s) 118
PsuI RGATCY 1 cut(s) 32
PvuII CAGCTG 1 cut(s) 61
RsaI GTAC 1 cut(s) 6
RsaNI GTAC 1 cut(s) 5
SaqAI TTAA 1 cut(s) 101
Sau3AI GATC 2 cut(s) 32, 47
SchI GAGTC 1 cut(s) 118
SetI ASST 1 cut(s) 63
SgeI CNNG 9 cut(s) 42, 51, 66, 74, 94, 98, 122, 132, 140
SmlI CTYRAG 1 cut(s) 126
SmoI CTYRAG 1 cut(s) 126
SphI GCATGC 1 cut(s) 85
Sse9I AATT 1 cut(s) 98
SspI AATATT 1 cut(s) 73
TaaI ACNGT 1 cut(s) 14
TasI AATT 1 cut(s) 98
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
XceI RCATGY 1 cut(s) 85
Zsp2I ATGCAT 2 cut(s) 83, 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.