Rh3BG167000

mRNA-capping

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
14383773 .. 14385290
1518 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG167000.1

Sequence Viewer

Length: 315 bp
ATGTTGCTATGGATGAGCGGTTTAAGGAGGAAAGTGAATATTCGGCCATTTTATGAGCGGTGGAAGATGCTTGAGAAAGAGGTCATAGAGCCTCGGAGTTACAAGTTTGTTGTCAAGTATATAATGTTCGGATTCATTAACATTATATACTTGATGAGCATAGAACCTGTCACTCAGCAAACGAAGGATGTCATGGTGGCAGTGATGGATTGCATGGCTATGTTCCTTCACTTGACCATGTTGTTGCTGATACTAGATTTAATTGCTGATTTAGCCCTTGATGCCACTAGAATAGTTGGAGTGGACCTCGGCTAG

Protein Analysis

104

Amino Acids

12.22

Weight (kDa)

7.86

Isoelectric Point (pI)

72.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020069)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 2 cut(s) 18, 58
AciI CCGC 2 cut(s) 18, 58
AcoI YGGCCR 1 cut(s) 44
AoxI GGCC 1 cut(s) 44
AspS9I GGNCC 1 cut(s) 304
AvaII GGWCC 1 cut(s) 304
BccI CCATC 1 cut(s) 199
BfaI CTAG 3 cut(s) 254, 288, 313
Bme18I GGWCC 1 cut(s) 304
BmgT120I GGNCC 1 cut(s) 304
BmsI GCATC 2 cut(s) 57, 271
BplI GAGNNNNNCTC 1 cut(s) 291
BpuEI CTTGAG 1 cut(s) 92
BsaJI CCNNGG 2 cut(s) 92, 307
BseDI CCNNGG 2 cut(s) 92, 307
BseGI GGATG 2 cut(s) 18, 193
BseMII CTCAG 1 cut(s) 188
BshFI GGCC 1 cut(s) 46
BsnI GGCC 1 cut(s) 46
BspACI CCGC 2 cut(s) 18, 58
BspANI GGCC 1 cut(s) 46
BspCNI CTCAG 1 cut(s) 187
BsrBI CCGCTC 2 cut(s) 18, 58
BssECI CCNNGG 2 cut(s) 92, 307
BstDEI CTNAG 1 cut(s) 174
BstF5I GGATG 2 cut(s) 18, 193
BstMWI GCNNNNNNNGC 2 cut(s) 272, 281
BsuRI GGCC 1 cut(s) 46
BtsCI GGATG 2 cut(s) 18, 193
BtsI GCAGTG 1 cut(s) 207
BtsIMutI CAGTG 1 cut(s) 207
Cfr13I GGNCC 1 cut(s) 304
CviAII CATG 3 cut(s) 193, 214, 238
CviJI RGCY 5 cut(s) 46, 91, 218, 275, 312
CviKI_1 RGCY 5 cut(s) 46, 91, 218, 275, 312
DdeI CTNAG 1 cut(s) 174
EaeI YGGCCR 1 cut(s) 44
Eco47I GGWCC 1 cut(s) 304
FaeI CATG 3 cut(s) 196, 217, 241
FatI CATG 3 cut(s) 192, 213, 237
FokI GGATG 2 cut(s) 25, 200
FspBI CTAG 3 cut(s) 254, 288, 313
HaeIII GGCC 1 cut(s) 46
Hin1II CATG 3 cut(s) 196, 217, 241
HinfI GANTC 1 cut(s) 132
Hpy166II GTNNAC 1 cut(s) 304
Hpy188I TCNGA 2 cut(s) 96, 131
Hpy8I GTNNAC 1 cut(s) 304
HpyAV CCTTC 2 cut(s) 178, 236
HpyCH4V TGCA 1 cut(s) 213
HpyF10VI GCNNNNNNNGC 2 cut(s) 272, 281
HpyF3I CTNAG 1 cut(s) 174
Hsp92II CATG 3 cut(s) 196, 217, 241
LpnPI CCDG 1 cut(s) 180
LweI GCATC 2 cut(s) 57, 271
MaeI CTAG 3 cut(s) 254, 288, 313
MaeIII GTNAC 2 cut(s) 98, 169
MbiI CCGCTC 2 cut(s) 18, 58
MboII GAAGA 1 cut(s) 76
MluCI AATT 1 cut(s) 261
MmeI TCCRAC 1 cut(s) 277
MnlI CCTC 3 cut(s) 21, 73, 102
MseI TTAA 3 cut(s) 23, 138, 260
MslI CAYNNNNRTG 1 cut(s) 218
MwoI GCNNNNNNNGC 2 cut(s) 272, 281
NlaIII CATG 3 cut(s) 196, 217, 241
NmeAIII GCCGAG 1 cut(s) 288
NmuCI GTSAC 1 cut(s) 169
PfeI GAWTC 1 cut(s) 132
PspPI GGNCC 1 cut(s) 304
PsrI GAACNNNNNNTAC 2 cut(s) 110, 142
RseI CAYNNNNRTG 1 cut(s) 218
SaqAI TTAA 3 cut(s) 23, 138, 260
Sau96I GGNCC 1 cut(s) 304
SetI ASST 3 cut(s) 84, 169, 309
SfaNI GCATC 2 cut(s) 57, 271
SinI GGWCC 1 cut(s) 304
SmiMI CAYNNNNRTG 1 cut(s) 218
SmlI CTYRAG 1 cut(s) 71
SmoI CTYRAG 1 cut(s) 71
Sse9I AATT 1 cut(s) 261
SsiI CCGC 2 cut(s) 18, 58
SspI AATATT 1 cut(s) 40
SspMI CTAG 3 cut(s) 254, 288, 313
TasI AATT 1 cut(s) 261
TfiI GAWTC 1 cut(s) 132
Tru1I TTAA 3 cut(s) 23, 138, 260
Tru9I TTAA 3 cut(s) 23, 138, 260
TscAI CASTG 1 cut(s) 207
TseFI GTSAC 1 cut(s) 169
Tsp45I GTSAC 1 cut(s) 169
TspDTI ATGAA 1 cut(s) 124
TspRI CASTG 1 cut(s) 207
VpaK11BI GGWCC 1 cut(s) 304
XspI CTAG 3 cut(s) 254, 288, 313
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.