Rh3CG311400

NPR1 interacting

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0018926
Physical Location & Seq
Reverse (-)
32735694 .. 32736756
1063 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG311400.1

Sequence Viewer

Length: 426 bp
ATGGCGGAAAACGAGAAGAAGACTGATGATCGTCAGGAACAAGAAGAAGAAGAGGAGATGGAGAAGGTAGAGAAGTTCTATTCCCTCATCAGACACTTTCGCGAGGCTCGGAATCGTCTGATCGGATTACGAAAGACACGGCCAAACCATGAGATCGGCGATGAAGTGGAGCAGGAGAAGATGAAAACCAGCAAGAAAAGGAAGAAAACGGGCGATGATGATCGTGATCATGAACGGAGATTGAGTACTTGGGTGCCATCATTTGAATGCGAGGATTTCACCAACAAAGAGGTTGAGTATCCAGGAACTTGTGTAAGCTTCCCTGCTCTTCCTTGTAACACTAGTGCTAACACTAGCAATAATGGTAAAGAAAAAGTAGCAGATGATGATGCTTCAGAGTGTCTGGACCTTCGACTTGCCCTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NPR1_interact

Protein Analysis

141

Amino Acids

16.5

Weight (kDa)

5.07

Isoelectric Point (pI)

54.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NPR1_interact PF15699 15 - 137 5e-18 NPR1 interacting
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018926)

Species Orthologous Gene IDs
pyrus_communis pycom09g19480
rosa_chinensis RchiOBHm_Chr3g0486821
rosa_laevigata RLG00000023060
rosa_roxburghii Rroxscaffold_6G00395560
rosa_rugosa Rorug03G0227300
rosa_samantha Rh3AG277400 Rh3BG312400 Rh3CG311400 Rh3DG307900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 253
AccII CGCG 1 cut(s) 102
AciI CCGC 1 cut(s) 5
AcoI YGGCCR 1 cut(s) 140
AcuI CTGAAG 1 cut(s) 378
AfaI GTAC 1 cut(s) 247
AgsI TTSAA 1 cut(s) 266
AhlI ACTAGT 1 cut(s) 341
AjnI CCWGG 1 cut(s) 301
AluBI AGCT 1 cut(s) 318
AluI AGCT 1 cut(s) 318
AoxI GGCC 1 cut(s) 140
AspS9I GGNCC 1 cut(s) 406
AsuHPI GGTGA 1 cut(s) 271
AvaII GGWCC 1 cut(s) 406
BanI GGYRCC 1 cut(s) 253
BbsI GAAGAC 1 cut(s) 26
BccI CCATC 2 cut(s) 52, 265
BceAI ACGGC 1 cut(s) 155
BciT130I CCWGG 1 cut(s) 303
BciVI GTATCC 1 cut(s) 309
BclI TGATCA 1 cut(s) 226
BcuI ACTAGT 1 cut(s) 341
BfaI CTAG 2 cut(s) 342, 354
BfuI GTATCC 1 cut(s) 309
BmcAI AGTACT 1 cut(s) 247
Bme1390I CCNGG 1 cut(s) 303
Bme18I GGWCC 1 cut(s) 406
BmgT120I GGNCC 1 cut(s) 406
BmiI GGNNCC 1 cut(s) 255
BmrFI CCNGG 1 cut(s) 303
BmsI GCATC 1 cut(s) 379
BpiI GAAGAC 1 cut(s) 26
BsaBI GATNNNNATC 2 cut(s) 219, 225
BsaXI ACNNNNNCTCC 2 cut(s) 229, 259
Bse8I GATNNNNATC 2 cut(s) 219, 225
BseBI CCWGG 1 cut(s) 303
BseJI GATNNNNATC 2 cut(s) 219, 225
BseRI GAGGAG 1 cut(s) 68
Bsh1236I CGCG 1 cut(s) 102
BshFI GGCC 1 cut(s) 142
BshNI GGYRCC 1 cut(s) 253
BsmI GAATGC 1 cut(s) 272
BsnI GGCC 1 cut(s) 142
Bsp143I GATC 5 cut(s) 28, 120, 153, 220, 226
Bsp68I TCGCGA 1 cut(s) 102
BspACI CCGC 1 cut(s) 5
BspANI GGCC 1 cut(s) 142
BspFNI CGCG 1 cut(s) 102
BspHI TCATGA 1 cut(s) 229
BspLI GGNNCC 1 cut(s) 255
BspQI GCTCTTC 1 cut(s) 333
BspT107I GGYRCC 1 cut(s) 253
BssMI GATC 5 cut(s) 28, 120, 153, 220, 226
Bst2UI CCWGG 1 cut(s) 303
Bst6I CTCTTC 2 cut(s) 45, 333
BstFNI CGCG 1 cut(s) 102
BstKTI GATC 5 cut(s) 31, 123, 156, 223, 229
BstMBI GATC 5 cut(s) 28, 120, 153, 220, 226
BstNI CCWGG 1 cut(s) 303
BstSCI CCNGG 1 cut(s) 301
BstUI CGCG 1 cut(s) 102
BstV2I GAAGAC 1 cut(s) 26
BsuI GTATCC 1 cut(s) 309
BsuRI GGCC 1 cut(s) 142
BtgZI GCGATG 2 cut(s) 174, 228
BtuMI TCGCGA 1 cut(s) 102
CciI TCATGA 1 cut(s) 229
Cfr13I GGNCC 1 cut(s) 406
Csp6I GTAC 1 cut(s) 246
CviAII CATG 2 cut(s) 149, 230
CviJI RGCY 3 cut(s) 107, 142, 318
CviKI_1 RGCY 3 cut(s) 107, 142, 318
CviQI GTAC 1 cut(s) 246
DpnI GATC 5 cut(s) 30, 122, 155, 222, 228
DpnII GATC 5 cut(s) 28, 120, 153, 220, 226
EaeI YGGCCR 1 cut(s) 140
Eam1104I CTCTTC 2 cut(s) 45, 333
EarI CTCTTC 2 cut(s) 45, 333
EciI GGCGGA 1 cut(s) 20
Eco47I GGWCC 1 cut(s) 406
Eco57I CTGAAG 1 cut(s) 378
EcoRII CCWGG 1 cut(s) 301
FaeI CATG 2 cut(s) 152, 233
FaiI YATR 2 cut(s) 150, 231
FatI CATG 2 cut(s) 148, 229
FbaI TGATCA 1 cut(s) 226
FspBI CTAG 2 cut(s) 342, 354
HaeIII GGCC 1 cut(s) 142
Hin1II CATG 2 cut(s) 152, 233
HindIII AAGCTT 1 cut(s) 316
HinfI GANTC 1 cut(s) 112
HphI GGTGA 1 cut(s) 271
Hpy188I TCNGA 5 cut(s) 92, 111, 120, 125, 397
Hpy188III TCNNGA 5 cut(s) 35, 101, 224, 230, 404
HpyAV CCTTC 2 cut(s) 58, 419
Hsp92II CATG 2 cut(s) 152, 233
Ksp22I TGATCA 1 cut(s) 226
Kzo9I GATC 5 cut(s) 28, 120, 153, 220, 226
LguI GCTCTTC 1 cut(s) 333
LmnI GCTCC 1 cut(s) 169
LpnPI CCDG 7 cut(s) 20, 158, 202, 288, 315, 336, 389
LweI GCATC 1 cut(s) 379
MaeI CTAG 2 cut(s) 342, 354
MaeIII GTNAC 1 cut(s) 335
MalI GATC 5 cut(s) 30, 122, 155, 222, 228
MboI GATC 5 cut(s) 28, 120, 153, 220, 226
MboII GAAGA 8 cut(s) 28, 31, 56, 59, 62, 190, 214, 320
MnlI CCTC 5 cut(s) 46, 95, 97, 265, 283
MslI CAYNNNNRTG 1 cut(s) 265
MspR9I CCNGG 1 cut(s) 303
Mva1269I GAATGC 1 cut(s) 272
MvaI CCWGG 1 cut(s) 303
MvnI CGCG 1 cut(s) 102
NdeII GATC 5 cut(s) 28, 120, 153, 220, 226
NlaIII CATG 2 cut(s) 152, 233
NlaIV GGNNCC 1 cut(s) 255
NruI TCGCGA 1 cut(s) 102
PagI TCATGA 1 cut(s) 229
PciSI GCTCTTC 1 cut(s) 333
PctI GAATGC 1 cut(s) 272
PfeI GAWTC 1 cut(s) 112
PfoI TCCNGGA 1 cut(s) 301
Psp6I CCWGG 1 cut(s) 301
PspGI CCWGG 1 cut(s) 301
PspN4I GGNNCC 1 cut(s) 255
PspPI GGNCC 1 cut(s) 406
RruI TCGCGA 1 cut(s) 102
RsaI GTAC 1 cut(s) 247
RsaNI GTAC 1 cut(s) 246
RseI CAYNNNNRTG 1 cut(s) 265
SapI GCTCTTC 1 cut(s) 333
Sau3AI GATC 5 cut(s) 28, 120, 153, 220, 226
Sau96I GGNCC 1 cut(s) 406
ScaI AGTACT 1 cut(s) 247
ScrFI CCNGG 1 cut(s) 303
SetI ASST 4 cut(s) 69, 294, 320, 411
SfaNI GCATC 1 cut(s) 379
SinI GGWCC 1 cut(s) 406
SmiMI CAYNNNNRTG 1 cut(s) 265
SpeI ACTAGT 1 cut(s) 341
SsiI CCGC 1 cut(s) 5
SspMI CTAG 2 cut(s) 342, 354
StyD4I CCNGG 1 cut(s) 301
TaqI TCGA 1 cut(s) 412
TatI WGTACW 1 cut(s) 245
TfiI GAWTC 1 cut(s) 112
TspDTI ATGAA 3 cut(s) 177, 197, 246
TspGWI ACGGA 1 cut(s) 250
VpaK11BI GGWCC 1 cut(s) 406
XspI CTAG 2 cut(s) 342, 354
ZrmI AGTACT 1 cut(s) 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.