Rh3CG336800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Reverse (-)
37616777 .. 37621231
4455 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG336800.1

Sequence Viewer

Length: 210 bp
ATGATTTCGCAGGATATAGGGGAAGGAGTTCTTGCTTCATGTGGGTCTTATTTTAAGTTAAAGCTTGGAGTTAGGCTCATTAGGCTAGCATTGGAAGCAGATGATTGGCTTAGCTCTGACTTAAATAAATTGAGTTGGGTTGTTTGGATCGTCAAGAAGGATTCTTTTTCAAGTTTCGGAATTGGGAAGCATGCATTGCTCAATGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.64

Weight (kDa)

7.89

Isoelectric Point (pI)

18.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018990)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 155
AgsI TTSAA 1 cut(s) 171
AluBI AGCT 2 cut(s) 64, 114
AluI AGCT 2 cut(s) 64, 114
AlwI GGATC 1 cut(s) 155
Asp700I GAANNNNTTC 1 cut(s) 27
AsuNHI GCTAGC 1 cut(s) 85
BfaI CTAG 1 cut(s) 86
BlpI GCTNAGC 1 cut(s) 110
BmtI GCTAGC 1 cut(s) 89
BplI GAGNNNNNCTC 2 cut(s) 60, 92
Bpu1102I GCTNAGC 1 cut(s) 110
Bse3DI GCAATG 1 cut(s) 194
BseMI GCAATG 1 cut(s) 194
Bsp143I GATC 1 cut(s) 147
Bsp1720I GCTNAGC 1 cut(s) 110
BspOI GCTAGC 1 cut(s) 89
BspPI GGATC 1 cut(s) 155
BsrDI GCAATG 1 cut(s) 194
BssMI GATC 1 cut(s) 147
BstAPI GCANNNNNTGC 1 cut(s) 196
BstC8I GCNNGC 2 cut(s) 87, 192
BstDEI CTNAG 1 cut(s) 110
BstKTI GATC 1 cut(s) 150
BstMBI GATC 1 cut(s) 147
BstMWI GCNNNNNNNGC 3 cut(s) 82, 95, 196
BstNSI RCATGY 1 cut(s) 194
Cac8I GCNNGC 2 cut(s) 87, 192
CviAII CATG 2 cut(s) 39, 191
CviJI RGCY 5 cut(s) 64, 76, 85, 109, 114
CviKI_1 RGCY 5 cut(s) 64, 76, 85, 109, 114
DdeI CTNAG 1 cut(s) 110
DpnI GATC 1 cut(s) 149
DpnII GATC 1 cut(s) 147
EcoT22I ATGCAT 1 cut(s) 196
FaeI CATG 2 cut(s) 42, 194
FaiI YATR 3 cut(s) 17, 40, 192
FalI AAGNNNNNCTT 2 cut(s) 15, 47
FatI CATG 2 cut(s) 38, 190
FspBI CTAG 1 cut(s) 86
Hin1II CATG 2 cut(s) 42, 194
HindIII AAGCTT 1 cut(s) 62
HinfI GANTC 1 cut(s) 161
Hpy188I TCNGA 2 cut(s) 118, 179
Hpy188III TCNNGA 1 cut(s) 154
HpyAV CCTTC 2 cut(s) 17, 151
HpyCH4V TGCA 1 cut(s) 194
HpyF10VI GCNNNNNNNGC 3 cut(s) 82, 95, 196
HpyF3I CTNAG 1 cut(s) 110
Hsp92II CATG 2 cut(s) 42, 194
Kzo9I GATC 1 cut(s) 147
MaeI CTAG 1 cut(s) 86
MalI GATC 1 cut(s) 149
MboI GATC 1 cut(s) 147
MluCI AATT 2 cut(s) 128, 180
Mph1103I ATGCAT 1 cut(s) 196
MroXI GAANNNNTTC 1 cut(s) 27
MseI TTAA 3 cut(s) 54, 59, 122
MwoI GCNNNNNNNGC 3 cut(s) 82, 95, 196
NdeII GATC 1 cut(s) 147
NheI GCTAGC 1 cut(s) 85
NlaIII CATG 2 cut(s) 42, 194
NsiI ATGCAT 1 cut(s) 196
NspI RCATGY 1 cut(s) 194
PaeI GCATGC 1 cut(s) 194
PdmI GAANNNNTTC 1 cut(s) 27
PfeI GAWTC 1 cut(s) 161
SaqAI TTAA 3 cut(s) 54, 59, 122
Sau3AI GATC 1 cut(s) 147
SetI ASST 2 cut(s) 66, 116
SgeI CNNG 8 cut(s) 23, 44, 51, 77, 98, 166, 183, 203
SphI GCATGC 1 cut(s) 194
Sse9I AATT 2 cut(s) 128, 180
SspMI CTAG 1 cut(s) 86
TasI AATT 2 cut(s) 128, 180
TfiI GAWTC 1 cut(s) 161
Tru1I TTAA 3 cut(s) 54, 59, 122
Tru9I TTAA 3 cut(s) 54, 59, 122
TspDTI ATGAA 1 cut(s) 27
XceI RCATGY 1 cut(s) 194
XmnI GAANNNNTTC 1 cut(s) 27
XspI CTAG 1 cut(s) 86
Zsp2I ATGCAT 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.