Rh4BG352000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
51273376 .. 51275382
2007 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG352000.1

Sequence Viewer

Length: 273 bp
ATGAATCTAAAGGAAGTCAAGCTTGACTTAAGGACAAACCCTTTGTTTTATCTGGACACTTGGTGGTTTCTCAACTTGAGAAAATGTCTTGGGAGGTTGAAGCAACTTGAAAGATTCACCTTAGAGCTTTCTTCTCCTACACAATCAATGGCCTCCATCTTGGGGCTCGCTGGGTCAGTCAATGCCAAAGTCAATGGAATCACAGTTGGGCATACGAAGCTTCACATTGAACAAGAATATGTTCTCCTTTATATATCTTCACCAAGCTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.3

Weight (kDa)

9.25

Isoelectric Point (pI)

45.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018426)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g28000
rosa_laevigata RLG00000006564
rosa_roxburghii Rroxscaffold_5G00376920
rosa_rugosa Rorug04G0288900
rosa_samantha Rh4AG343400 Rh4BG351900 Rh4BG352000 Rh4CG366500 Rh4DG346000
rosa_wichuraiana Rw4G029980

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 63
AfiI CCNNNNNNNGG 1 cut(s) 162
AflII CTTAAG 1 cut(s) 28
AgsI TTSAA 3 cut(s) 100, 110, 230
AluBI AGCT 4 cut(s) 22, 127, 220, 267
AluI AGCT 4 cut(s) 22, 127, 220, 267
AoxI GGCC 1 cut(s) 150
ArsI GACNNNNNNTTYG 2 cut(s) 25, 57
Asp700I GAANNNNTTC 1 cut(s) 240
AsuHPI GGTGA 2 cut(s) 109, 252
BanII GRGCYC 1 cut(s) 168
BccI CCATC 1 cut(s) 164
BfrI CTTAAG 1 cut(s) 28
BpuEI CTTGAG 1 cut(s) 97
Bsc4I CCNNNNNNNGG 1 cut(s) 162
BseLI CCNNNNNNNGG 1 cut(s) 162
BseYI CCCAGC 1 cut(s) 170
BshFI GGCC 1 cut(s) 152
BslI CCNNNNNNNGG 1 cut(s) 162
BsnI GGCC 1 cut(s) 152
Bsp1286I GDGCHC 1 cut(s) 168
BspANI GGCC 1 cut(s) 152
BspTI CTTAAG 1 cut(s) 28
Bst4CI ACNGT 1 cut(s) 205
BstAFI CTTAAG 1 cut(s) 28
BstC8I GCNNGC 1 cut(s) 168
BstDEI CTNAG 1 cut(s) 121
BstMWI GCNNNNNNNGC 1 cut(s) 217
BsuRI GGCC 1 cut(s) 152
Cac8I GCNNGC 1 cut(s) 168
CviJI RGCY 6 cut(s) 22, 127, 152, 166, 220, 267
CviKI_1 RGCY 6 cut(s) 22, 127, 152, 166, 220, 267
DdeI CTNAG 1 cut(s) 121
DraIII CACNNNGTG 1 cut(s) 63
Eco24I GRGCYC 1 cut(s) 168
EcoT38I GRGCYC 1 cut(s) 168
FaiI YATR 4 cut(s) 213, 240, 252, 254
FalI AAGNNNNNCTT 3 cut(s) 38, 11, 43
FriOI GRGCYC 1 cut(s) 168
GsaI CCCAGC 1 cut(s) 174
HaeIII GGCC 1 cut(s) 152
HindIII AAGCTT 3 cut(s) 20, 218, 265
HinfI GANTC 3 cut(s) 4, 114, 198
HphI GGTGA 2 cut(s) 109, 252
Hpy188III TCNNGA 1 cut(s) 53
HpyCH4III ACNGT 1 cut(s) 205
HpyF10VI GCNNNNNNNGC 1 cut(s) 217
HpyF3I CTNAG 1 cut(s) 121
LpnPI CCDG 2 cut(s) 38, 156
MboII GAAGA 2 cut(s) 123, 249
MhlI GDGCHC 1 cut(s) 168
MnlI CCTC 2 cut(s) 87, 163
MroXI GAANNNNTTC 1 cut(s) 240
MseI TTAA 2 cut(s) 29, 271
MspCI CTTAAG 1 cut(s) 28
MwoI GCNNNNNNNGC 1 cut(s) 217
PdmI GAANNNNTTC 1 cut(s) 240
PfeI GAWTC 3 cut(s) 4, 114, 198
PspFI CCCAGC 1 cut(s) 170
SaqAI TTAA 2 cut(s) 29, 271
SduI GDGCHC 1 cut(s) 168
SetI ASST 6 cut(s) 24, 98, 122, 129, 222, 269
SmlI CTYRAG 2 cut(s) 28, 76
SmoI CTYRAG 2 cut(s) 28, 76
TaaI ACNGT 1 cut(s) 205
TfiI GAWTC 3 cut(s) 4, 114, 198
Tru1I TTAA 2 cut(s) 29, 271
Tru9I TTAA 2 cut(s) 29, 271
TspDTI ATGAA 1 cut(s) 17
Vha464I CTTAAG 1 cut(s) 28
XmnI GAANNNNTTC 1 cut(s) 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.