Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr4C

Orthogroup ID

OG0020448

Physical Location & Seq

Genomic Coordinates Forward (+)

58004854 .. 58006439

Gene Structure 1586 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh4CG317200.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 234 bp

ATGGACCAAGGATCCTTTGAGGTTGGCAACGTAAACAGAAAACATCTTCTATTAAATCTCAAGGTAAATAGTGTGTTTGATTCCTGCAAGGATGAAAATGATTGTATTCAAGATGATGAAGTGAGCCTAGGAGCTGATTCCTTGCAAATGGATGGGTCTTCTGAATGTGACAGTGAGGTTCATCAATCATTAGAGGATCAGAGTTGCTCCTGGAGTCCGAATTTGCAATGGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0000228 GO:0000280 GO:0000785 GO:0000793 GO:0000794 GO:0003006 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005694 GO:0006139 GO:0006259 GO:0006310 GO:0006725 GO:0006807 GO:0006996 GO:0007049 GO:0007059 GO:0007127 GO:0007129 GO:0007131 GO:0007275 GO:0008150 GO:0008152 GO:0009553 GO:0009554 GO:0009555 GO:0009556 GO:0009987 GO:0016043 GO:0019953 GO:0022402 GO:0022414 GO:0022607 GO:0031974 GO:0031981 GO:0032501 GO:0032502 GO:0034293 GO:0034641 GO:0035825 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0043934 GO:0044085 GO:0044237 GO:0044238 GO:0044260 GO:0044422 GO:0044424 GO:0044427 GO:0044428 GO:0044446 GO:0044464 GO:0044703 GO:0045132 GO:0045143 GO:0046483 GO:0048229 GO:0048236 GO:0048285 GO:0048856 GO:0048869 GO:0051026 GO:0051276 GO:0051321 GO:0051704 GO:0061982 GO:0070013 GO:0070192 GO:0071704 GO:0071840 GO:0090304 GO:0098813 GO:0140013 GO:1901360 GO:1903046

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

HORMA

Protein Analysis

77

Amino Acids

8.61

Weight (kDa)

4.05

Isoelectric Point (pI)

67.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020448)

Species	Orthologous Gene IDs
pyrus_communis	pycom13g10350
rosa_laevigata	RLG00000006973
rosa_roxburghii	Rroxscaffold_5G00371690 Rroxscaffold_5G00372150
rosa_samantha	Rh4CG317200
rosa_wichuraiana	Rw4G025580

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	3 cut(s)	6, 19, 204
AcsI	RAATTY	1 cut(s)	220
AgsI	TTSAA	1 cut(s)	110
AjnI	CCWGG	1 cut(s)	209
AluBI	AGCT	1 cut(s)	134
AluI	AGCT	1 cut(s)	134
AlwI	GGATC	3 cut(s)	6, 19, 204
ApoI	RAATTY	1 cut(s)	220
AspA2I	CCTAGG	1 cut(s)	127
AspS9I	GGNCC	1 cut(s)	4
AvaII	GGWCC	1 cut(s)	4
AvrII	CCTAGG	1 cut(s)	127
BamHI	GGATCC	1 cut(s)	11
BbsI	GAAGAC	1 cut(s)	150
BccI	CCATC	1 cut(s)	146
BciT130I	CCWGG	1 cut(s)	211
BfaI	CTAG	1 cut(s)	128
BlnI	CCTAGG	1 cut(s)	127
Bme1390I	CCNGG	1 cut(s)	211
Bme18I	GGWCC	1 cut(s)	4
BmgT120I	GGNCC	1 cut(s)	4
BmiI	GGNNCC	1 cut(s)	13
BmrFI	CCNGG	1 cut(s)	211
BpiI	GAAGAC	1 cut(s)	150
BpmI	CTGGAG	1 cut(s)	232
BpuEI	CTTGAG	1 cut(s)	44
BsaJI	CCNNGG	2 cut(s)	7, 127
Bse3DI	GCAATG	1 cut(s)	233
BseBI	CCWGG	1 cut(s)	211
BseDI	CCNNGG	2 cut(s)	7, 127
BseGI	GGATG	2 cut(s)	97, 157
BseMI	GCAATG	1 cut(s)	233
Bsp143I	GATC	2 cut(s)	11, 196
BspLI	GGNNCC	1 cut(s)	13
BspPI	GGATC	3 cut(s)	6, 19, 204
BsrDI	GCAATG	1 cut(s)	233
BssECI	CCNNGG	2 cut(s)	7, 127
BssMI	GATC	2 cut(s)	11, 196
BssT1I	CCWWGG	2 cut(s)	7, 127
Bst2UI	CCWGG	1 cut(s)	211
Bst4CI	ACNGT	1 cut(s)	173
BstF5I	GGATG	2 cut(s)	97, 157
BstKTI	GATC	2 cut(s)	14, 199
BstMBI	GATC	2 cut(s)	11, 196
BstNI	CCWGG	1 cut(s)	211
BstSCI	CCNGG	1 cut(s)	209
BstV2I	GAAGAC	1 cut(s)	150
BstX2I	RGATCY	1 cut(s)	11
BstYI	RGATCY	1 cut(s)	11
BtsCI	GGATG	2 cut(s)	97, 157
BtsIMutI	CAGTG	1 cut(s)	178
Cfr13I	GGNCC	1 cut(s)	4
CviJI	RGCY	2 cut(s)	126, 134
CviKI_1	RGCY	2 cut(s)	126, 134
DpnI	GATC	2 cut(s)	13, 198
DpnII	GATC	2 cut(s)	11, 196
Eco130I	CCWWGG	2 cut(s)	7, 127
Eco47I	GGWCC	1 cut(s)	4
EcoRII	CCWGG	1 cut(s)	209
EcoT14I	CCWWGG	2 cut(s)	7, 127
ErhI	CCWWGG	2 cut(s)	7, 127
FokI	GGATG	2 cut(s)	104, 164
FspBI	CTAG	1 cut(s)	128
GsuI	CTGGAG	1 cut(s)	232
HinfI	GANTC	3 cut(s)	80, 137, 214
Hpy166II	GTNNAC	1 cut(s)	34
Hpy188I	TCNGA	3 cut(s)	163, 201, 219
Hpy188III	TCNNGA	1 cut(s)	110
Hpy8I	GTNNAC	1 cut(s)	34
HpyCH4III	ACNGT	1 cut(s)	173
HpyCH4IV	ACGT	1 cut(s)	30
HpyCH4V	TGCA	3 cut(s)	87, 145, 226
HpySE526I	ACGT	1 cut(s)	30
Kzo9I	GATC	2 cut(s)	11, 196
LmnI	GCTCC	2 cut(s)	131, 212
LpnPI	CCDG	3 cut(s)	97, 196, 223
MaeI	CTAG	1 cut(s)	128
MaeII	ACGT	1 cut(s)	30
MaeIII	GTNAC	1 cut(s)	167
MalI	GATC	2 cut(s)	13, 198
MboI	GATC	2 cut(s)	11, 196
MboII	GAAGA	2 cut(s)	38, 150
MflI	RGATCY	1 cut(s)	11
MluCI	AATT	1 cut(s)	220
MlyI	GAGTC	1 cut(s)	223
MnlI	CCTC	3 cut(s)	13, 169, 187
MseI	TTAA	1 cut(s)	53
MspR9I	CCNGG	1 cut(s)	211
MvaI	CCWGG	1 cut(s)	211
NdeII	GATC	2 cut(s)	11, 196
NlaIV	GGNNCC	1 cut(s)	13
NmuCI	GTSAC	1 cut(s)	167
PfeI	GAWTC	2 cut(s)	80, 137
PfoI	TCCNGGA	1 cut(s)	209
PleI	GAGTC	1 cut(s)	222
PpsI	GAGTC	1 cut(s)	222
Psp6I	CCWGG	1 cut(s)	209
PspGI	CCWGG	1 cut(s)	209
PspN4I	GGNNCC	1 cut(s)	13
PspPI	GGNCC	1 cut(s)	4
PsuI	RGATCY	1 cut(s)	11
SaqAI	TTAA	1 cut(s)	53
Sau3AI	GATC	2 cut(s)	11, 196
Sau96I	GGNCC	1 cut(s)	4
SchI	GAGTC	1 cut(s)	223
ScrFI	CCNGG	1 cut(s)	211
SetI	ASST	5 cut(s)	24, 33, 66, 136, 180
SgeI	CNNG	9 cut(s)	20, 73, 96, 100, 122, 140, 154, 222, 223
SinI	GGWCC	1 cut(s)	4
SmlI	CTYRAG	1 cut(s)	59
SmoI	CTYRAG	1 cut(s)	59
Sse9I	AATT	1 cut(s)	220
SspMI	CTAG	1 cut(s)	128
StyD4I	CCNGG	1 cut(s)	209
StyI	CCWWGG	2 cut(s)	7, 127
TaaI	ACNGT	1 cut(s)	173
TaiI	ACGT	1 cut(s)	33
TasI	AATT	1 cut(s)	220
TfiI	GAWTC	2 cut(s)	80, 137
Tru1I	TTAA	1 cut(s)	53
Tru9I	TTAA	1 cut(s)	53
TscAI	CASTG	1 cut(s)	178
TseFI	GTSAC	1 cut(s)	167
Tsp45I	GTSAC	1 cut(s)	167
TspDTI	ATGAA	3 cut(s)	108, 132, 170
TspRI	CASTG	1 cut(s)	178
VpaK11BI	GGWCC	1 cut(s)	4
XapI	RAATTY	1 cut(s)	220
XmaJI	CCTAGG	1 cut(s)	127
XspI	CTAG	1 cut(s)	128

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.