Rh4CG411900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
65724656 .. 65726046
1391 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG411900.1

Sequence Viewer

Length: 249 bp
ATGTCATCATCTCCAAAGAGATTGTTAATGGGATTTGCTATCTTTGTGCTTCTGCTTTTGGGAATGGCTTCAGTGGGAAGTTGCAGCAGGCCTTTGAAGAATTTGAAGGAAATGGAAATGAAAAGCTTGATGGAGGCTAAGCTTCCCAGAGGGCCAGTACCTCCTTCAGGACCTTCTCGGTGTCACAACAAGCTCAGCCCCACCAAGAACACCCAGCTTTTTACCCAAGATTATGTCATCTGCCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.01

Weight (kDa)

9.86

Isoelectric Point (pI)

65.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017930)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G01379 AT2G25125
fragaria_vesca FvH4_4g32331
prunus_persica Prupe.1G324000_v2.0.a1
rosa_chinensis RchiOBHm_Chr4g0441131
rosa_multiflora Rmu_sc0006317.1_g000019
rosa_roxburghii Rroxscaffold_5G00382100
rosa_rugosa Rorug04G0331400
rosa_samantha Rh4BG396900 Rh4CG411900 Rh4DG389800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 100
AcuI CTGAAG 2 cut(s) 54, 150
AfaI GTAC 1 cut(s) 159
AfiI CCNNNNNNNGG 1 cut(s) 167
AgsI TTSAA 2 cut(s) 97, 106
AluBI AGCT 4 cut(s) 126, 142, 193, 217
AluI AGCT 4 cut(s) 126, 142, 193, 217
AoxI GGCC 2 cut(s) 89, 152
ApeKI GCWGC 1 cut(s) 84
ApoI RAATTY 1 cut(s) 100
Asp700I GAANNNNTTC 1 cut(s) 67
AspS9I GGNCC 2 cut(s) 152, 170
AvaII GGWCC 1 cut(s) 170
BbvI GCAGC 1 cut(s) 96
BccI CCATC 1 cut(s) 124
BisI GCNGC 1 cut(s) 85
BlpI GCTNAGC 2 cut(s) 138, 194
BlsI GCNGC 1 cut(s) 86
Bme18I GGWCC 1 cut(s) 170
BmgT120I GGNCC 2 cut(s) 152, 170
Bpu1102I GCTNAGC 2 cut(s) 138, 194
Bsc4I CCNNNNNNNGG 1 cut(s) 167
Bse1I ACTGG 1 cut(s) 155
BseLI CCNNNNNNNGG 1 cut(s) 167
BseMII CTCAG 1 cut(s) 208
BseNI ACTGG 1 cut(s) 155
BseXI GCAGC 1 cut(s) 96
BseYI CCCAGC 1 cut(s) 213
BshFI GGCC 2 cut(s) 91, 154
BslI CCNNNNNNNGG 1 cut(s) 167
BsnI GGCC 2 cut(s) 91, 154
Bsp1720I GCTNAGC 2 cut(s) 138, 194
BspANI GGCC 2 cut(s) 91, 154
BspCNI CTCAG 1 cut(s) 207
BsrI ACTGG 1 cut(s) 155
BstC8I GCNNGC 1 cut(s) 89
BstDEI CTNAG 2 cut(s) 138, 194
BstENI CCTNNNNNAGG 1 cut(s) 165
BstV1I GCAGC 1 cut(s) 96
BsuRI GGCC 2 cut(s) 91, 154
BtsIMutI CAGTG 1 cut(s) 78
Cac8I GCNNGC 1 cut(s) 89
Cfr13I GGNCC 2 cut(s) 152, 170
Csp6I GTAC 1 cut(s) 158
CviAII CATG 1 cut(s) 246
CviJI RGCY 9 cut(s) 68, 91, 126, 137, 142, 154, 193, 198, 217
CviKI_1 RGCY 9 cut(s) 68, 91, 126, 137, 142, 154, 193, 198, 217
CviQI GTAC 1 cut(s) 158
DdeI CTNAG 2 cut(s) 138, 194
Eco147I AGGCCT 1 cut(s) 91
Eco47I GGWCC 1 cut(s) 170
Eco57I CTGAAG 2 cut(s) 54, 150
EcoNI CCTNNNNNAGG 1 cut(s) 165
EcoO109I RGGNCCY 1 cut(s) 170
FaeI CATG 1 cut(s) 249
FaiI YATR 2 cut(s) 234, 247
FatI CATG 1 cut(s) 245
Fnu4HI GCNGC 1 cut(s) 85
Fsp4HI GCNGC 1 cut(s) 85
GluI GCNGC 1 cut(s) 85
GsaI CCCAGC 1 cut(s) 217
HaeIII GGCC 2 cut(s) 91, 154
Hin1II CATG 1 cut(s) 249
HindIII AAGCTT 2 cut(s) 124, 140
Hpy188III TCNNGA 1 cut(s) 168
HpyAV CCTTC 3 cut(s) 100, 174, 183
HpyCH4V TGCA 1 cut(s) 84
HpyF3I CTNAG 2 cut(s) 138, 194
Hsp92II CATG 1 cut(s) 249
LpnPI CCDG 5 cut(s) 73, 153, 160, 168, 227
Lsp1109I GCAGC 1 cut(s) 96
MaeIII GTNAC 1 cut(s) 182
MboII GAAGA 1 cut(s) 109
MluCI AATT 1 cut(s) 100
MnlI CCTC 3 cut(s) 127, 143, 171
MroXI GAANNNNTTC 1 cut(s) 67
MseI TTAA 1 cut(s) 26
NlaIII CATG 1 cut(s) 249
NmuCI GTSAC 1 cut(s) 182
PceI AGGCCT 1 cut(s) 91
PdmI GAANNNNTTC 1 cut(s) 67
PkrI GCNGC 1 cut(s) 86
PpuMI RGGWCCY 1 cut(s) 170
Psp5II RGGWCCY 1 cut(s) 170
PspFI CCCAGC 1 cut(s) 213
PspPI GGNCC 2 cut(s) 152, 170
PspPPI RGGWCCY 1 cut(s) 170
RsaI GTAC 1 cut(s) 159
RsaNI GTAC 1 cut(s) 158
SaqAI TTAA 1 cut(s) 26
SatI GCNGC 1 cut(s) 85
Sau96I GGNCC 2 cut(s) 152, 170
SetI ASST 6 cut(s) 128, 144, 163, 175, 195, 219
SinI GGWCC 1 cut(s) 170
Sse9I AATT 1 cut(s) 100
SseBI AGGCCT 1 cut(s) 91
StuI AGGCCT 1 cut(s) 91
TasI AATT 1 cut(s) 100
Tru1I TTAA 1 cut(s) 26
Tru9I TTAA 1 cut(s) 26
TscAI CASTG 1 cut(s) 78
TseFI GTSAC 1 cut(s) 182
TseI GCWGC 1 cut(s) 84
Tsp45I GTSAC 1 cut(s) 182
TspDTI ATGAA 1 cut(s) 134
TspRI CASTG 1 cut(s) 78
VpaK11BI GGWCC 1 cut(s) 170
XagI CCTNNNNNAGG 1 cut(s) 165
XapI RAATTY 1 cut(s) 100
XmnI GAANNNNTTC 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.