Rh4DG399300

PLATZ transcription factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Forward (+)
61552672 .. 61555762
3091 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG399300.1

Sequence Viewer

Length: 501 bp
ATGAAAGCTCATTGTCTCCATACAAAGCTTCAAATCTGCAAATATGTATATCATGATGTACTTCGCCTTCAAGAAATTCAGAAGCATGTTGATTGTGCTAGAATTCAGACATATAAAATCAATGGTGACAAAGCTGTGCATCTAAATCCTCGTCCAATGTCCAAGGATGCCAAACCATCAACAAAAGCAAAGTTTGGTTCTGCTTGTGATGTTTGTGGTAGATATCTACAAGACATGCCAAATCGCTTCTGCTCCATTGCTTGTAAGGCCTCTGTAGAATCAGTGAAGCCTAAACACCAAAGTCACGAATTCATCGCCTTTGGAATTCCAGAATGTGGTGGCTATTCACCTCAAGGGAATAACAATTCGGAAACATATATGAGTGAAATGGAATCCTCTATCTCGTCTGAGGAGATGAATGCTTGGGTAAGTTCAGCACTGAAGCCAAGGAGGCATTTGCACAAGAGGAAAGGCATCCCGCACAGGTCTCCTTTATGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

166

Amino Acids

18.79

Weight (kDa)

9.24

Isoelectric Point (pI)

64.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PLATZ PF04640 14 - 89 3.7e-27 PLATZ transcription factor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017081)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G01818 AT2G01818
fragaria_vesca FvH4_4g33250
malus_domestica MD13G1017800.v1.1 MD16G1015800.v1.1
prunus_persica Prupe.1G335800_v2.0.a1
pyrus_communis pycom16g01470
rosa_chinensis RchiOBHm_Chr4g0442401
rosa_laevigata RLG00000006013
rosa_samantha Rh4AG392500 Rh4CG421300 Rh4DG399300
rosa_wichuraiana Rw4G033900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 335
AciI CCGC 1 cut(s) 479
AcsI RAATTY 4 cut(s) 75, 102, 308, 324
AcuI CTGAAG 1 cut(s) 461
AfaI GTAC 1 cut(s) 60
AfiI CCNNNNNNNGG 1 cut(s) 335
AgsI TTSAA 2 cut(s) 32, 71
AluBI AGCT 3 cut(s) 8, 28, 134
AluI AGCT 3 cut(s) 8, 28, 134
Alw26I GTCTC 2 cut(s) 20, 492
AoxI GGCC 1 cut(s) 267
ApoI RAATTY 4 cut(s) 75, 102, 308, 324
AsuHPI GGTGA 2 cut(s) 137, 339
BarI GAAGNNNNNNTAC 2 cut(s) 51, 83
BccI CCATC 1 cut(s) 184
BcoDI GTCTC 2 cut(s) 20, 492
BfaI CTAG 1 cut(s) 99
BfmI CTRYAG 1 cut(s) 273
BglI GCCNNNNNGGC 1 cut(s) 451
BmsI GCATC 3 cut(s) 148, 157, 483
BpuEI CTTGAG 1 cut(s) 336
BsaI GGTCTC 1 cut(s) 492
BsaJI CCNNGG 2 cut(s) 162, 446
Bsc4I CCNNNNNNNGG 1 cut(s) 335
Bse3DI GCAATG 1 cut(s) 255
BseDI CCNNGG 2 cut(s) 162, 446
BseGI GGATG 2 cut(s) 172, 474
BseLI CCNNNNNNNGG 1 cut(s) 335
BseMI GCAATG 1 cut(s) 255
BseMII CTCAG 1 cut(s) 399
BseRI GAGGAG 1 cut(s) 425
BshFI GGCC 1 cut(s) 269
BslI CCNNNNNNNGG 1 cut(s) 335
BsmAI GTCTC 2 cut(s) 20, 492
BsmI GAATGC 1 cut(s) 424
BsnI GGCC 1 cut(s) 269
Bso31I GGTCTC 1 cut(s) 492
BspACI CCGC 1 cut(s) 479
BspANI GGCC 1 cut(s) 269
BspCNI CTCAG 1 cut(s) 400
BspHI TCATGA 1 cut(s) 52
BspTNI GGTCTC 1 cut(s) 492
BsrDI GCAATG 1 cut(s) 255
BssECI CCNNGG 2 cut(s) 162, 446
BssT1I CCWWGG 2 cut(s) 162, 446
BstDEI CTNAG 1 cut(s) 408
BstF5I GGATG 2 cut(s) 172, 474
BstMAI GTCTC 2 cut(s) 20, 492
BstMWI GCNNNNNNNGC 2 cut(s) 266, 451
BstNSI RCATGY 2 cut(s) 89, 238
BstSFI CTRYAG 1 cut(s) 273
BsuRI GGCC 1 cut(s) 269
BtgZI GCGATG 1 cut(s) 298
BtsCI GGATG 2 cut(s) 172, 474
BtsIMutI CAGTG 2 cut(s) 288, 437
CciI TCATGA 1 cut(s) 52
Csp6I GTAC 1 cut(s) 59
CviAII CATG 3 cut(s) 53, 86, 235
CviJI RGCY 7 cut(s) 8, 28, 134, 269, 289, 342, 445
CviKI_1 RGCY 7 cut(s) 8, 28, 134, 269, 289, 342, 445
CviQI GTAC 1 cut(s) 59
DdeI CTNAG 1 cut(s) 408
Eco130I CCWWGG 2 cut(s) 162, 446
Eco147I AGGCCT 1 cut(s) 269
Eco31I GGTCTC 1 cut(s) 492
Eco32I GATATC 1 cut(s) 224
Eco57I CTGAAG 1 cut(s) 461
EcoRI GAATTC 3 cut(s) 102, 308, 324
EcoRV GATATC 1 cut(s) 224
EcoT14I CCWWGG 2 cut(s) 162, 446
ErhI CCWWGG 2 cut(s) 162, 446
FaeI CATG 3 cut(s) 56, 89, 238
FatI CATG 3 cut(s) 52, 85, 234
FauI CCCGC 1 cut(s) 486
FokI GGATG 2 cut(s) 179, 461
FspBI CTAG 1 cut(s) 99
HaeIII GGCC 1 cut(s) 269
Hin1II CATG 3 cut(s) 56, 89, 238
HindIII AAGCTT 1 cut(s) 26
HinfI GANTC 2 cut(s) 278, 392
HphI GGTGA 2 cut(s) 137, 339
Hpy188I TCNGA 4 cut(s) 81, 108, 370, 409
Hpy188III TCNNGA 4 cut(s) 53, 71, 305, 329
HpyAV CCTTC 1 cut(s) 77
HpyCH4V TGCA 3 cut(s) 39, 139, 460
HpyF10VI GCNNNNNNNGC 2 cut(s) 266, 451
HpyF3I CTNAG 1 cut(s) 408
Hsp92II CATG 3 cut(s) 56, 89, 238
LmnI GCTCC 1 cut(s) 257
LpnPI CCDG 2 cut(s) 342, 469
LweI GCATC 3 cut(s) 148, 157, 483
MaeI CTAG 1 cut(s) 99
MaeIII GTNAC 2 cut(s) 125, 302
MluCI AATT 5 cut(s) 75, 102, 308, 324, 364
MnlI CCTC 7 cut(s) 159, 280, 360, 403, 406, 444, 459
Mva1269I GAATGC 1 cut(s) 424
MwoI GCNNNNNNNGC 2 cut(s) 266, 451
NlaIII CATG 3 cut(s) 56, 89, 238
NmuCI GTSAC 2 cut(s) 125, 302
NspI RCATGY 2 cut(s) 89, 238
PagI TCATGA 1 cut(s) 52
PceI AGGCCT 1 cut(s) 269
PctI GAATGC 1 cut(s) 424
PfeI GAWTC 2 cut(s) 278, 392
PflMI CCANNNNNTGG 1 cut(s) 335
RsaI GTAC 1 cut(s) 60
RsaNI GTAC 1 cut(s) 59
SetI ASST 5 cut(s) 10, 30, 136, 352, 488
SfaNI GCATC 3 cut(s) 148, 157, 483
SfcI CTRYAG 1 cut(s) 273
SmlI CTYRAG 1 cut(s) 351
SmoI CTYRAG 1 cut(s) 351
Sse9I AATT 5 cut(s) 75, 102, 308, 324, 364
SseBI AGGCCT 1 cut(s) 269
SsiI CCGC 1 cut(s) 479
SspMI CTAG 1 cut(s) 99
StuI AGGCCT 1 cut(s) 269
StyI CCWWGG 2 cut(s) 162, 446
TasI AATT 5 cut(s) 75, 102, 308, 324, 364
TatI WGTACW 1 cut(s) 58
TfiI GAWTC 2 cut(s) 278, 392
TscAI CASTG 2 cut(s) 288, 444
TseFI GTSAC 2 cut(s) 125, 302
Tsp45I GTSAC 2 cut(s) 125, 302
TspDTI ATGAA 3 cut(s) 17, 301, 431
TspRI CASTG 2 cut(s) 288, 444
Van91I CCANNNNNTGG 1 cut(s) 335
XapI RAATTY 4 cut(s) 75, 102, 308, 324
XceI RCATGY 2 cut(s) 89, 238
XspI CTAG 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.