Rh5BG344500

Reactive mitochondrial oxygen species modulator 1

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
52495551 .. 52498124
2574 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG344500.1

Sequence Viewer

Length: 186 bp
ATGATGTTTTATCTGCCTATGTTTTTGTATCCAGGTGTGATGTATGGCTCATTTGAGGCTATAAGGTGTAAGGTGCCAGGGGTAGAGAAGATCAGGTATGTTGGGCAAAGGACGATTGGCAGTGCAGCTGTTTTCAGCCTTTTCTTAAGTGCTGGTGCATTGATACATTGTGGAAAGTCATATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

6.77

Weight (kDa)

9.39

Isoelectric Point (pI)

18.13

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Romo1 PF10247 12 - 57 8e-12 Reactive mitochondrial oxygen species modulator 1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017205)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G07910
fragaria_vesca FvH4_3g28030
malus_domestica MD00G1126200.v1.1 MD00G1154200.v1.1
prunus_persica Prupe.4G268400_v2.0.a1
pyrus_communis pycom03g12330 pycom11g16150
rosa_chinensis RchiOBHm_Chr5g0050711
rosa_multiflora Rmu_sc0002117.1_g000026
rosa_roxburghii Rroxscaffold_1G00030070
rosa_rugosa Rorug05G0263200
rosa_samantha Rh5BG344500
rosa_wichuraiana Rw5G031630

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 73
AflII CTTAAG 1 cut(s) 145
AjnI CCWGG 2 cut(s) 31, 76
AluBI AGCT 1 cut(s) 128
AluI AGCT 1 cut(s) 128
ApeKI GCWGC 1 cut(s) 125
BanI GGYRCC 1 cut(s) 73
BbvI GCAGC 1 cut(s) 137
BciT130I CCWGG 2 cut(s) 33, 78
BciVI GTATCC 1 cut(s) 39
BfrI CTTAAG 1 cut(s) 145
BfuI GTATCC 1 cut(s) 39
BisI GCNGC 1 cut(s) 126
BlsI GCNGC 1 cut(s) 127
Bme1390I CCNGG 2 cut(s) 33, 78
BmiI GGNNCC 1 cut(s) 75
BmrFI CCNGG 2 cut(s) 33, 78
BsaJI CCNNGG 1 cut(s) 77
BseBI CCWGG 2 cut(s) 33, 78
BseDI CCNNGG 1 cut(s) 77
BseXI GCAGC 1 cut(s) 137
BsgI GTGCAG 1 cut(s) 144
BshNI GGYRCC 1 cut(s) 73
Bsp143I GATC 1 cut(s) 90
BspLI GGNNCC 1 cut(s) 75
BspT107I GGYRCC 1 cut(s) 73
BspTI CTTAAG 1 cut(s) 145
BssECI CCNNGG 1 cut(s) 77
BssMI GATC 1 cut(s) 90
Bst2UI CCWGG 2 cut(s) 33, 78
BstAFI CTTAAG 1 cut(s) 145
BstKTI GATC 1 cut(s) 93
BstMBI GATC 1 cut(s) 90
BstNI CCWGG 2 cut(s) 33, 78
BstSCI CCNGG 2 cut(s) 31, 76
BstV1I GCAGC 1 cut(s) 137
BsuI GTATCC 1 cut(s) 39
BtsI GCAGTG 1 cut(s) 127
BtsIMutI CAGTG 1 cut(s) 127
CviJI RGCY 4 cut(s) 48, 59, 128, 138
CviKI_1 RGCY 4 cut(s) 48, 59, 128, 138
DpnI GATC 1 cut(s) 92
DpnII GATC 1 cut(s) 90
EcoRII CCWGG 2 cut(s) 31, 76
FaiI YATR 5 cut(s) 20, 45, 62, 99, 181
Fnu4HI GCNGC 1 cut(s) 126
Fsp4HI GCNGC 1 cut(s) 126
GluI GCNGC 1 cut(s) 126
HpyCH4V TGCA 2 cut(s) 125, 158
Kzo9I GATC 1 cut(s) 90
LpnPI CCDG 6 cut(s) 18, 45, 63, 79, 90, 138
Lsp1109I GCAGC 1 cut(s) 137
MalI GATC 1 cut(s) 92
MboI GATC 1 cut(s) 90
MboII GAAGA 1 cut(s) 100
MnlI CCTC 1 cut(s) 49
MseI TTAA 2 cut(s) 146, 184
MspA1I CMGCKG 1 cut(s) 128
MspCI CTTAAG 1 cut(s) 145
MspR9I CCNGG 2 cut(s) 33, 78
MvaI CCWGG 2 cut(s) 33, 78
NdeII GATC 1 cut(s) 90
NlaIV GGNNCC 1 cut(s) 75
PkrI GCNGC 1 cut(s) 127
Psp6I CCWGG 2 cut(s) 31, 76
PspGI CCWGG 2 cut(s) 31, 76
PspN4I GGNNCC 1 cut(s) 75
PvuII CAGCTG 1 cut(s) 128
SaqAI TTAA 2 cut(s) 146, 184
SatI GCNGC 1 cut(s) 126
Sau3AI GATC 1 cut(s) 90
ScrFI CCNGG 2 cut(s) 33, 78
SetI ASST 5 cut(s) 37, 68, 75, 98, 130
SgeI CNNG 6 cut(s) 44, 45, 89, 90, 106, 165
SmlI CTYRAG 1 cut(s) 145
SmoI CTYRAG 1 cut(s) 145
StyD4I CCNGG 2 cut(s) 31, 76
Tru1I TTAA 2 cut(s) 146, 184
Tru9I TTAA 2 cut(s) 146, 184
TscAI CASTG 1 cut(s) 127
TseI GCWGC 1 cut(s) 125
TspRI CASTG 1 cut(s) 127
Vha464I CTTAAG 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.