Rh5CG561000
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
78566405 .. 78567371
967 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG561000.1

Sequence Viewer

Length: 309 bp
ATGGAAATTGCGGTGAACTCTAGAGTCGGATCTGAAACTCTTTTTTGGGTCTCTGAGAAGGTTAAATCTCAAGTGGCTCCCAACCGAGTAGATCAAATCTATCGCAGTTGGGAATCATCGGTTGTTTATGGTGCGTTGCTGAAAATTGAATTTAGATTCTCAGACCCAATTAAGGGGCTCCGAGCAGCAATCAAAATCAAGGGGGAAGTGAGCTGCTTCAGCTGTTGTGATGAAGATGATATGCATAAAGCAACTGACAATGGAGGTGCTTACATGATGAACCTACAAGTAATGCTCACCATCCTATAG

Protein Analysis

102

Amino Acids

11.47

Weight (kDa)

5.77

Isoelectric Point (pI)

44.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 11
AclWI GGATC 1 cut(s) 37
AcsI RAATTY 1 cut(s) 149
AcuI CTGAAG 1 cut(s) 202
AfiI CCNNNNNNNGG 2 cut(s) 172, 173
AgsI TTSAA 1 cut(s) 149
AluBI AGCT 2 cut(s) 213, 222
AluI AGCT 2 cut(s) 213, 222
Alw26I GTCTC 1 cut(s) 55
AlwI GGATC 1 cut(s) 37
ApeKI GCWGC 2 cut(s) 185, 213
ApoI RAATTY 1 cut(s) 149
AsuHPI GGTGA 2 cut(s) 25, 289
BanII GRGCYC 1 cut(s) 180
BbvI GCAGC 2 cut(s) 197, 200
BccI CCATC 1 cut(s) 308
BcoDI GTCTC 1 cut(s) 55
BfaI CTAG 1 cut(s) 21
BfmI CTRYAG 1 cut(s) 305
BisI GCNGC 2 cut(s) 186, 214
BlsI GCNGC 2 cut(s) 187, 215
BmiI GGNNCC 2 cut(s) 78, 179
BpuEI CTTGAG 1 cut(s) 54
BsaI GGTCTC 1 cut(s) 55
Bsc4I CCNNNNNNNGG 2 cut(s) 172, 173
BseGI GGATG 1 cut(s) 300
BseLI CCNNNNNNNGG 2 cut(s) 172, 173
BseMII CTCAG 2 cut(s) 45, 174
BseXI GCAGC 2 cut(s) 197, 200
BslI CCNNNNNNNGG 2 cut(s) 172, 173
BsmAI GTCTC 1 cut(s) 55
Bso31I GGTCTC 1 cut(s) 55
Bsp1286I GDGCHC 1 cut(s) 180
Bsp143I GATC 2 cut(s) 29, 91
BspACI CCGC 1 cut(s) 11
BspCNI CTCAG 2 cut(s) 46, 173
BspLI GGNNCC 2 cut(s) 78, 179
BspPI GGATC 1 cut(s) 37
BspTNI GGTCTC 1 cut(s) 55
BssMI GATC 2 cut(s) 29, 91
BstDEI CTNAG 2 cut(s) 54, 160
BstF5I GGATG 1 cut(s) 300
BstKTI GATC 2 cut(s) 32, 94
BstMAI GTCTC 1 cut(s) 55
BstMBI GATC 2 cut(s) 29, 91
BstMWI GCNNNNNNNGC 1 cut(s) 219
BstSFI CTRYAG 1 cut(s) 305
BstV1I GCAGC 2 cut(s) 197, 200
BstX2I RGATCY 1 cut(s) 29
BstYI RGATCY 1 cut(s) 29
BtsCI GGATG 1 cut(s) 300
CviAII CATG 1 cut(s) 274
CviJI RGCY 4 cut(s) 77, 178, 213, 222
CviKI_1 RGCY 4 cut(s) 77, 178, 213, 222
DdeI CTNAG 2 cut(s) 54, 160
DpnI GATC 2 cut(s) 31, 93
DpnII GATC 2 cut(s) 29, 91
Eco24I GRGCYC 1 cut(s) 180
Eco31I GGTCTC 1 cut(s) 55
Eco57I CTGAAG 1 cut(s) 202
EcoT22I ATGCAT 1 cut(s) 246
EcoT38I GRGCYC 1 cut(s) 180
FaeI CATG 1 cut(s) 277
FaiI YATR 5 cut(s) 129, 242, 246, 275, 307
FatI CATG 1 cut(s) 273
Fnu4HI GCNGC 2 cut(s) 186, 214
FokI GGATG 1 cut(s) 287
FriOI GRGCYC 1 cut(s) 180
Fsp4HI GCNGC 2 cut(s) 186, 214
FspBI CTAG 1 cut(s) 21
GluI GCNGC 2 cut(s) 186, 214
Hin1II CATG 1 cut(s) 277
HinfI GANTC 3 cut(s) 24, 113, 156
HphI GGTGA 2 cut(s) 25, 289
Hpy166II GTNNAC 1 cut(s) 16
Hpy188I TCNGA 5 cut(s) 29, 34, 55, 163, 182
Hpy188III TCNNGA 1 cut(s) 21
Hpy8I GTNNAC 1 cut(s) 16
HpyAV CCTTC 1 cut(s) 52
HpyCH4V TGCA 1 cut(s) 244
HpyF10VI GCNNNNNNNGC 1 cut(s) 219
HpyF3I CTNAG 2 cut(s) 54, 160
Hsp92II CATG 1 cut(s) 277
Kzo9I GATC 2 cut(s) 29, 91
LmnI GCTCC 2 cut(s) 82, 183
Lsp1109I GCAGC 2 cut(s) 197, 200
MaeI CTAG 1 cut(s) 21
MalI GATC 2 cut(s) 31, 93
MboI GATC 2 cut(s) 29, 91
MboII GAAGA 1 cut(s) 245
MflI RGATCY 1 cut(s) 29
MhlI GDGCHC 1 cut(s) 180
MluCI AATT 4 cut(s) 6, 144, 149, 168
MlyI GAGTC 1 cut(s) 33
MmeI TCCRAC 1 cut(s) 7
MnlI CCTC 1 cut(s) 257
Mph1103I ATGCAT 1 cut(s) 246
MseI TTAA 2 cut(s) 63, 171
MspA1I CMGCKG 1 cut(s) 222
MwoI GCNNNNNNNGC 1 cut(s) 219
NdeII GATC 2 cut(s) 29, 91
NlaIII CATG 1 cut(s) 277
NlaIV GGNNCC 2 cut(s) 78, 179
NsiI ATGCAT 1 cut(s) 246
PfeI GAWTC 2 cut(s) 113, 156
PkrI GCNGC 2 cut(s) 187, 215
PleI GAGTC 1 cut(s) 32
PpsI GAGTC 1 cut(s) 32
PspN4I GGNNCC 2 cut(s) 78, 179
PsuI RGATCY 1 cut(s) 29
PvuII CAGCTG 1 cut(s) 222
SaqAI TTAA 2 cut(s) 63, 171
SatI GCNGC 2 cut(s) 186, 214
Sau3AI GATC 2 cut(s) 29, 91
SchI GAGTC 1 cut(s) 33
SduI GDGCHC 1 cut(s) 180
SetI ASST 5 cut(s) 63, 215, 224, 268, 285
SfcI CTRYAG 1 cut(s) 305
SgeI CNNG 7 cut(s) 33, 83, 98, 194, 211, 286, 299
SmlI CTYRAG 1 cut(s) 69
SmoI CTYRAG 1 cut(s) 69
Sse9I AATT 4 cut(s) 6, 144, 149, 168
SsiI CCGC 1 cut(s) 11
SspMI CTAG 1 cut(s) 21
TasI AATT 4 cut(s) 6, 144, 149, 168
TfiI GAWTC 2 cut(s) 113, 156
Tru1I TTAA 2 cut(s) 63, 171
Tru9I TTAA 2 cut(s) 63, 171
TseI GCWGC 2 cut(s) 185, 213
TspDTI ATGAA 2 cut(s) 246, 293
XapI RAATTY 1 cut(s) 149
XbaI TCTAGA 1 cut(s) 20
XspI CTAG 1 cut(s) 21
Zsp2I ATGCAT 1 cut(s) 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.