Rh5DG090000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0019114
Physical Location & Seq
Forward (+)
8102423 .. 8112620
10198 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG090000.1

Sequence Viewer

Length: 189 bp
ATGGCAGCTAGAGTTGGAGTTCTTCCTAATCATAGTGATCGGAAAACCATCATGAACCTCAACTTGGTGGTGATACTAGTTCTCTGCAGTTTTGGATCAGTCAAAGTCGAAGCTCTTTCAACTCGTCTTCCATCTACTGAAGAGGCAATTGAGATTATGAAACAAAGGCGGTGGTGGGAAGGGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.01

Weight (kDa)

9.18

Isoelectric Point (pI)

59.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 169
AclWI GGATC 1 cut(s) 103
AcuI CTGAAG 1 cut(s) 159
AfiI CCNNNNNNNGG 1 cut(s) 64
AgsI TTSAA 1 cut(s) 120
AhlI ACTAGT 1 cut(s) 76
AjuI GAANNNNNNNTTGG 2 cut(s) 47, 79
AluBI AGCT 2 cut(s) 8, 113
AluI AGCT 2 cut(s) 8, 113
AlwI GGATC 1 cut(s) 103
ApeKI GCWGC 1 cut(s) 5
AsuHPI GGTGA 1 cut(s) 82
BbsI GAAGAC 1 cut(s) 119
BbvI GCAGC 1 cut(s) 17
BccI CCATC 2 cut(s) 56, 139
BcuI ACTAGT 1 cut(s) 76
BfaI CTAG 2 cut(s) 9, 77
BfmI CTRYAG 1 cut(s) 85
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
BpiI GAAGAC 1 cut(s) 119
Bsc4I CCNNNNNNNGG 1 cut(s) 64
BseLI CCNNNNNNNGG 1 cut(s) 64
BseXI GCAGC 1 cut(s) 17
BslI CCNNNNNNNGG 1 cut(s) 64
Bsp143I GATC 2 cut(s) 37, 95
BspACI CCGC 1 cut(s) 169
BspHI TCATGA 1 cut(s) 51
BspMAI CTGCAG 1 cut(s) 89
BspPI GGATC 1 cut(s) 103
BssMI GATC 2 cut(s) 37, 95
Bst6I CTCTTC 1 cut(s) 135
BstKTI GATC 2 cut(s) 40, 98
BstMBI GATC 2 cut(s) 37, 95
BstSFI CTRYAG 1 cut(s) 85
BstV1I GCAGC 1 cut(s) 17
BstV2I GAAGAC 1 cut(s) 119
CciI TCATGA 1 cut(s) 51
CspCI CAANNNNNGTGG 2 cut(s) 152, 187
CviAII CATG 1 cut(s) 52
CviJI RGCY 2 cut(s) 8, 113
CviKI_1 RGCY 2 cut(s) 8, 113
DpnI GATC 2 cut(s) 39, 97
DpnII GATC 2 cut(s) 37, 95
Eam1104I CTCTTC 1 cut(s) 135
EarI CTCTTC 1 cut(s) 135
Eco57I CTGAAG 1 cut(s) 159
FaeI CATG 1 cut(s) 55
FaiI YATR 3 cut(s) 33, 53, 158
FatI CATG 1 cut(s) 51
Fnu4HI GCNGC 1 cut(s) 6
Fsp4HI GCNGC 1 cut(s) 6
FspBI CTAG 2 cut(s) 9, 77
GluI GCNGC 1 cut(s) 6
Hin1II CATG 1 cut(s) 55
HphI GGTGA 1 cut(s) 82
Hpy188I TCNGA 1 cut(s) 42
Hpy188III TCNNGA 1 cut(s) 52
HpyAV CCTTC 1 cut(s) 173
HpyCH4V TGCA 1 cut(s) 87
Hsp92II CATG 1 cut(s) 55
Kzo9I GATC 2 cut(s) 37, 95
Lsp1109I GCAGC 1 cut(s) 17
MaeI CTAG 2 cut(s) 9, 77
MalI GATC 2 cut(s) 39, 97
MboI GATC 2 cut(s) 37, 95
MboII GAAGA 3 cut(s) 14, 119, 152
MfeI CAATTG 1 cut(s) 147
MluCI AATT 1 cut(s) 147
MnlI CCTC 2 cut(s) 68, 136
MunI CAATTG 1 cut(s) 147
NdeII GATC 2 cut(s) 37, 95
NlaIII CATG 1 cut(s) 55
PagI TCATGA 1 cut(s) 51
PkrI GCNGC 1 cut(s) 7
PstI CTGCAG 1 cut(s) 89
SatI GCNGC 1 cut(s) 6
Sau3AI GATC 2 cut(s) 37, 95
SetI ASST 3 cut(s) 10, 60, 115
SfcI CTRYAG 1 cut(s) 85
SgeI CNNG 5 cut(s) 21, 64, 76, 89, 135
SpeI ACTAGT 1 cut(s) 76
Sse9I AATT 1 cut(s) 147
SsiI CCGC 1 cut(s) 169
SspMI CTAG 2 cut(s) 9, 77
TaqI TCGA 1 cut(s) 108
TasI AATT 1 cut(s) 147
TseI GCWGC 1 cut(s) 5
TspDTI ATGAA 2 cut(s) 68, 173
XspI CTAG 2 cut(s) 9, 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.