Rh5DG501500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0021615
Physical Location & Seq
Reverse (-)
78571452 .. 78571703
252 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG501500.1

Sequence Viewer

Length: 252 bp
ATGATCGACGTCCCGGGAACACTGAGTTCACCCAAGCAAATTCTTGATGGCTTCCCCGGATGCCTCCCTGGACATCCTCTCGGTGCCTCATCACAAACTTCACCCGCCGGCTCTATCCACCACCTCACACTGCCTCTGGATGAGAAGCTACTCGATCGGTACACCCGGAATGACTTCGGGCCTCGCTACCTTCCTCACCTCCCGGCGGTCAATCCGACGGAGCCAGCATCCCGGGCCCTAGCATACCGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

8.94

Weight (kDa)

6.89

Isoelectric Point (pI)

54.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021615)

Species Orthologous Gene IDs
rosa_multiflora Rmu_ssc0000042.1_g000016
rosa_roxburghii Rroxscaffold_4G00321590 Rroxscaffold_4G00322540
rosa_samantha Rh1CG083400 Rh5DG501500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 12
AccB1I GGYRCC 1 cut(s) 83
AciI CCGC 2 cut(s) 105, 206
AcsI RAATTY 1 cut(s) 39
AcyI GRCGYC 1 cut(s) 9
AfaI GTAC 1 cut(s) 161
AfiI CCNNNNNNNGG 1 cut(s) 205
AgeI ACCGGT 1 cut(s) 246
AjnI CCWGG 1 cut(s) 67
AluBI AGCT 1 cut(s) 148
AluI AGCT 1 cut(s) 148
Ama87I CYCGRG 2 cut(s) 13, 231
AoxI GGCC 2 cut(s) 179, 234
ApaI GGGCCC 1 cut(s) 238
ApoI RAATTY 1 cut(s) 39
AsiGI ACCGGT 1 cut(s) 246
Asp700I GAANNNNTTC 1 cut(s) 173
AspS9I GGNCC 3 cut(s) 179, 234, 235
AsuC2I CCSGG 7 cut(s) 14, 15, 57, 166, 203, 232, 233
AsuHPI GGTGA 3 cut(s) 21, 93, 188
AvaI CYCGRG 2 cut(s) 13, 231
BaeGI GKGCMC 1 cut(s) 238
BanI GGYRCC 1 cut(s) 83
BanII GRGCYC 1 cut(s) 238
BccI CCATC 1 cut(s) 41
BciT130I CCWGG 1 cut(s) 69
BcnI CCSGG 7 cut(s) 14, 15, 57, 166, 203, 232, 233
BfaI CTAG 1 cut(s) 239
Bme1390I CCNGG 8 cut(s) 14, 15, 57, 69, 166, 203, 232, 233
BmeT110I CYCGRG 2 cut(s) 13, 231
BmgT120I GGNCC 3 cut(s) 179, 234, 235
BmiI GGNNCC 3 cut(s) 85, 222, 236
BmrFI CCNGG 8 cut(s) 14, 15, 57, 69, 166, 203, 232, 233
BmsI GCATC 2 cut(s) 50, 236
BpuMI CCSGG 7 cut(s) 14, 15, 57, 166, 203, 232, 233
BsaHI GRCGYC 1 cut(s) 9
BsaJI CCNNGG 4 cut(s) 13, 55, 67, 231
BsaWI WCCGGW 1 cut(s) 246
Bsc4I CCNNNNNNNGG 1 cut(s) 205
Bse118I RCCGGY 2 cut(s) 107, 246
BseBI CCWGG 1 cut(s) 69
BseDI CCNNGG 4 cut(s) 13, 55, 67, 231
BseGI GGATG 4 cut(s) 65, 73, 145, 227
BseLI CCNNNNNNNGG 1 cut(s) 205
BseMII CTCAG 1 cut(s) 14
BseSI GKGCMC 1 cut(s) 238
Bsh1285I CGRYCG 1 cut(s) 157
BshFI GGCC 2 cut(s) 181, 236
BshNI GGYRCC 1 cut(s) 83
BshTI ACCGGT 1 cut(s) 246
BsiEI CGRYCG 1 cut(s) 157
BsiHKCI CYCGRG 2 cut(s) 13, 231
BsiSI CCGG 7 cut(s) 14, 57, 108, 166, 203, 232, 247
BslI CCNNNNNNNGG 1 cut(s) 205
BsnI GGCC 2 cut(s) 181, 236
BsoBI CYCGRG 2 cut(s) 13, 231
Bsp120I GGGCCC 1 cut(s) 234
Bsp1286I GDGCHC 1 cut(s) 238
Bsp143I GATC 2 cut(s) 3, 154
BspACI CCGC 2 cut(s) 105, 206
BspANI GGCC 2 cut(s) 181, 236
BspCNI CTCAG 1 cut(s) 15
BspLI GGNNCC 3 cut(s) 85, 222, 236
BspT107I GGYRCC 1 cut(s) 83
BsrFI RCCGGY 2 cut(s) 107, 246
BssAI RCCGGY 2 cut(s) 107, 246
BssECI CCNNGG 4 cut(s) 13, 55, 67, 231
BssMI GATC 2 cut(s) 3, 154
BssNI GRCGYC 1 cut(s) 9
Bst2UI CCWGG 1 cut(s) 69
BstACI GRCGYC 1 cut(s) 9
BstC8I GCNNGC 2 cut(s) 109, 225
BstDEI CTNAG 1 cut(s) 23
BstF5I GGATG 4 cut(s) 65, 73, 145, 227
BstKTI GATC 2 cut(s) 6, 157
BstMBI GATC 2 cut(s) 3, 154
BstMCI CGRYCG 1 cut(s) 157
BstMWI GCNNNNNNNGC 1 cut(s) 233
BstNI CCWGG 1 cut(s) 69
BstSCI CCNGG 8 cut(s) 12, 13, 55, 67, 164, 201, 230, 231
BstSLI GKGCMC 1 cut(s) 238
BsuRI GGCC 2 cut(s) 181, 236
BtsCI GGATG 4 cut(s) 65, 73, 145, 227
BtsI GCAGTG 1 cut(s) 128
BtsIMutI CAGTG 2 cut(s) 20, 128
Cac8I GCNNGC 2 cut(s) 109, 225
Cfr10I RCCGGY 2 cut(s) 107, 246
Cfr13I GGNCC 3 cut(s) 179, 234, 235
Cfr9I CCCGGG 2 cut(s) 13, 231
Csp6I GTAC 1 cut(s) 160
CspAI ACCGGT 1 cut(s) 246
CviJI RGCY 6 cut(s) 51, 111, 148, 181, 223, 236
CviKI_1 RGCY 6 cut(s) 51, 111, 148, 181, 223, 236
CviQI GTAC 1 cut(s) 160
DdeI CTNAG 1 cut(s) 23
DpnI GATC 2 cut(s) 5, 156
DpnII GATC 2 cut(s) 3, 154
Eco24I GRGCYC 1 cut(s) 238
Eco88I CYCGRG 2 cut(s) 13, 231
EcoO109I RGGNCCY 1 cut(s) 235
EcoRII CCWGG 1 cut(s) 67
EcoT38I GRGCYC 1 cut(s) 238
FaiI YATR 1 cut(s) 244
FauI CCCGC 1 cut(s) 112
FokI GGATG 4 cut(s) 60, 72, 152, 214
FriOI GRGCYC 1 cut(s) 238
FspBI CTAG 1 cut(s) 239
HaeIII GGCC 2 cut(s) 181, 236
HapII CCGG 7 cut(s) 14, 57, 108, 166, 203, 232, 247
Hin1I GRCGYC 1 cut(s) 9
HpaII CCGG 7 cut(s) 14, 57, 108, 166, 203, 232, 247
HphI GGTGA 3 cut(s) 21, 93, 188
Hpy166II GTNNAC 2 cut(s) 29, 162
Hpy188I TCNGA 1 cut(s) 216
Hpy188III TCNNGA 2 cut(s) 44, 137
Hpy8I GTNNAC 2 cut(s) 29, 162
Hpy99I CGWCG 2 cut(s) 11, 220
HpyAV CCTTC 1 cut(s) 200
HpyCH4IV ACGT 1 cut(s) 9
HpyF10VI GCNNNNNNNGC 1 cut(s) 233
HpyF3I CTNAG 1 cut(s) 23
HpySE526I ACGT 1 cut(s) 9
Hsp92I GRCGYC 1 cut(s) 9
KroI GCCGGC 1 cut(s) 107
KroNI GCCGGC 1 cut(s) 109
Kzo9I GATC 2 cut(s) 3, 154
LmnI GCTCC 1 cut(s) 220
LweI GCATC 2 cut(s) 50, 236
MaeI CTAG 1 cut(s) 239
MaeII ACGT 1 cut(s) 9
MalI GATC 2 cut(s) 5, 156
MboI GATC 2 cut(s) 3, 154
MhlI GDGCHC 1 cut(s) 238
MluCI AATT 1 cut(s) 39
MmeI TCCRAC 1 cut(s) 239
MnlI CCTC 8 cut(s) 74, 87, 97, 134, 144, 192, 204, 209
MroNI GCCGGC 1 cut(s) 107
MroXI GAANNNNTTC 1 cut(s) 173
MspI CCGG 7 cut(s) 14, 57, 108, 166, 203, 232, 247
MspR9I CCNGG 8 cut(s) 14, 15, 57, 69, 166, 203, 232, 233
MvaI CCWGG 1 cut(s) 69
MwoI GCNNNNNNNGC 1 cut(s) 233
NaeI GCCGGC 1 cut(s) 109
NciI CCSGG 7 cut(s) 14, 15, 57, 166, 203, 232, 233
NdeII GATC 2 cut(s) 3, 154
NgoMIV GCCGGC 1 cut(s) 107
NlaIV GGNNCC 3 cut(s) 85, 222, 236
PdiI GCCGGC 1 cut(s) 109
PdmI GAANNNNTTC 1 cut(s) 173
PinAI ACCGGT 1 cut(s) 246
Ple19I CGATCG 1 cut(s) 157
Psp6I CCWGG 1 cut(s) 67
PspGI CCWGG 1 cut(s) 67
PspN4I GGNNCC 3 cut(s) 85, 222, 236
PspOMI GGGCCC 1 cut(s) 234
PspPI GGNCC 3 cut(s) 179, 234, 235
PvuI CGATCG 1 cut(s) 157
RsaI GTAC 1 cut(s) 161
RsaNI GTAC 1 cut(s) 160
Sau3AI GATC 2 cut(s) 3, 154
Sau96I GGNCC 3 cut(s) 179, 234, 235
ScrFI CCNGG 8 cut(s) 14, 15, 57, 69, 166, 203, 232, 233
SduI GDGCHC 1 cut(s) 238
SetI ASST 5 cut(s) 12, 126, 150, 192, 201
SfaNI GCATC 2 cut(s) 50, 236
SmaI CCCGGG 2 cut(s) 15, 233
Sse9I AATT 1 cut(s) 39
SsiI CCGC 2 cut(s) 105, 206
SspMI CTAG 1 cut(s) 239
StyD4I CCNGG 8 cut(s) 12, 13, 55, 67, 164, 201, 230, 231
TaiI ACGT 1 cut(s) 12
TaqI TCGA 2 cut(s) 6, 153
TasI AATT 1 cut(s) 39
TscAI CASTG 2 cut(s) 27, 135
TspGWI ACGGA 1 cut(s) 233
TspMI CCCGGG 2 cut(s) 13, 231
TspRI CASTG 2 cut(s) 27, 135
XapI RAATTY 1 cut(s) 39
XmaI CCCGGG 2 cut(s) 13, 231
XmnI GAANNNNTTC 1 cut(s) 173
XspI CTAG 1 cut(s) 239
ZraI GACGTC 1 cut(s) 10
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.