Rh7AG139300

Belongs to the spermidine spermine synthase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
11241775 .. 11242241
467 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG139300.1

Sequence Viewer

Length: 327 bp
ATGCTTAAACTACAGTTCCTGCGTATTCAAGGCAAGAGCAGAAGAATTCCTTTGTATTCTAACTTCTCACTATTAAAACTACGGCTATTTGCTAATGTATTCTACTGTGGAATCCGATCTGTTTCCAGCGGCATAATCGGTTTCAAGCTTTGCTCCCCTGAAGGACCAGCAGTGGACTTCAAACACCCTACGAATCCACTGAACCCTGAGAATTATGGTGTGGCAAATGTACCCCACAAGTTCTACAACTCGGAGATGCACACTGCTGCATTCCAGCTCCCCGCATTCGCAAAGAAGGCCATCGAGGCTATTAGCTCCAAAATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

108

Amino Acids

12.1

Weight (kDa)

9.95

Isoelectric Point (pI)

47.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019232)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g05120 FvH4_5g05120
malus_domestica MD06G1177500.v1.1
pyrus_communis pycom14g15270
rosa_roxburghii Rroxscaffold_3G00261740
rosa_rugosa Rorug07G0012500
rosa_samantha Rh7AG139300 Rh7CG143500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 129, 282
AcsI RAATTY 1 cut(s) 45
AcuI CTGAAG 1 cut(s) 180
AfaI GTAC 1 cut(s) 231
AgsI TTSAA 3 cut(s) 29, 145, 181
AluBI AGCT 3 cut(s) 148, 277, 315
AluI AGCT 3 cut(s) 148, 277, 315
AlwNI CAGNNNCTG 1 cut(s) 19
AoxI GGCC 1 cut(s) 297
ApeKI GCWGC 1 cut(s) 266
ApoI RAATTY 1 cut(s) 45
AspS9I GGNCC 1 cut(s) 164
AvaII GGWCC 1 cut(s) 164
BarI GAAGNNNNNNTAC 2 cut(s) 47, 79
BbvI GCAGC 1 cut(s) 253
BccI CCATC 1 cut(s) 308
BceAI ACGGC 1 cut(s) 98
BfmI CTRYAG 1 cut(s) 11
BglI GCCNNNNNGGC 1 cut(s) 305
BisI GCNGC 2 cut(s) 130, 267
BlsI GCNGC 2 cut(s) 131, 268
Bme18I GGWCC 1 cut(s) 164
BmgT120I GGNCC 1 cut(s) 164
BmsI GCATC 1 cut(s) 246
BseMII CTCAG 1 cut(s) 198
BseXI GCAGC 1 cut(s) 253
BshFI GGCC 1 cut(s) 299
BsmI GAATGC 2 cut(s) 269, 284
BsnI GGCC 1 cut(s) 299
Bsp143I GATC 1 cut(s) 116
BspACI CCGC 2 cut(s) 129, 282
BspANI GGCC 1 cut(s) 299
BspCNI CTCAG 1 cut(s) 199
BssMI GATC 1 cut(s) 116
Bst4CI ACNGT 2 cut(s) 15, 107
BstDEI CTNAG 1 cut(s) 207
BstKTI GATC 1 cut(s) 119
BstMBI GATC 1 cut(s) 116
BstMWI GCNNNNNNNGC 2 cut(s) 296, 305
BstSFI CTRYAG 1 cut(s) 11
BstV1I GCAGC 1 cut(s) 253
BsuRI GGCC 1 cut(s) 299
BtsI GCAGTG 2 cut(s) 177, 261
BtsIMutI CAGTG 3 cut(s) 177, 197, 261
CaiI CAGNNNCTG 1 cut(s) 19
Cfr13I GGNCC 1 cut(s) 164
Csp6I GTAC 1 cut(s) 230
CviJI RGCY 6 cut(s) 85, 148, 277, 299, 308, 315
CviKI_1 RGCY 6 cut(s) 85, 148, 277, 299, 308, 315
CviQI GTAC 1 cut(s) 230
DdeI CTNAG 1 cut(s) 207
DpnI GATC 1 cut(s) 118
DpnII GATC 1 cut(s) 116
Eco47I GGWCC 1 cut(s) 164
Eco57I CTGAAG 1 cut(s) 180
EcoRI GAATTC 1 cut(s) 45
FaiI YATR 2 cut(s) 134, 216
FalI AAGNNNNNCTT 2 cut(s) 34, 66
FauI CCCGC 1 cut(s) 289
Fnu4HI GCNGC 2 cut(s) 130, 267
Fsp4HI GCNGC 2 cut(s) 130, 267
GluI GCNGC 2 cut(s) 130, 267
HaeIII GGCC 1 cut(s) 299
HindIII AAGCTT 1 cut(s) 146
HinfI GANTC 2 cut(s) 111, 193
Hpy166II GTNNAC 1 cut(s) 175
Hpy188I TCNGA 3 cut(s) 116, 253, 326
Hpy8I GTNNAC 1 cut(s) 175
HpyAV CCTTC 2 cut(s) 155, 289
HpyCH4III ACNGT 2 cut(s) 15, 107
HpyCH4V TGCA 2 cut(s) 259, 269
HpyF10VI GCNNNNNNNGC 2 cut(s) 296, 305
HpyF3I CTNAG 1 cut(s) 207
Kzo9I GATC 1 cut(s) 116
LmnI GCTCC 3 cut(s) 158, 282, 320
LpnPI CCDG 6 cut(s) 32, 139, 171, 180, 219, 287
Lsp1109I GCAGC 1 cut(s) 253
LweI GCATC 1 cut(s) 246
MalI GATC 1 cut(s) 118
MboI GATC 1 cut(s) 116
MboII GAAGA 1 cut(s) 54
MluCI AATT 2 cut(s) 45, 211
MnlI CCTC 1 cut(s) 298
MseI TTAA 2 cut(s) 6, 74
MspA1I CMGCKG 1 cut(s) 129
Mva1269I GAATGC 2 cut(s) 269, 284
MwoI GCNNNNNNNGC 2 cut(s) 296, 305
NdeII GATC 1 cut(s) 116
PctI GAATGC 2 cut(s) 269, 284
PfeI GAWTC 2 cut(s) 111, 193
PkrI GCNGC 2 cut(s) 131, 268
PspPI GGNCC 1 cut(s) 164
PstNI CAGNNNCTG 1 cut(s) 19
RsaI GTAC 1 cut(s) 231
RsaNI GTAC 1 cut(s) 230
SaqAI TTAA 2 cut(s) 6, 74
SatI GCNGC 2 cut(s) 130, 267
Sau3AI GATC 1 cut(s) 116
Sau96I GGNCC 1 cut(s) 164
SetI ASST 3 cut(s) 150, 279, 317
SfaNI GCATC 1 cut(s) 246
SfcI CTRYAG 1 cut(s) 11
SinI GGWCC 1 cut(s) 164
Sse9I AATT 2 cut(s) 45, 211
SsiI CCGC 2 cut(s) 129, 282
TaaI ACNGT 2 cut(s) 15, 107
TaqI TCGA 1 cut(s) 303
TasI AATT 2 cut(s) 45, 211
TauI GCSGC 1 cut(s) 132
TfiI GAWTC 2 cut(s) 111, 193
Tru1I TTAA 2 cut(s) 6, 74
Tru9I TTAA 2 cut(s) 6, 74
TscAI CASTG 3 cut(s) 177, 204, 268
TseI GCWGC 1 cut(s) 266
TspRI CASTG 3 cut(s) 177, 204, 268
VpaK11BI GGWCC 1 cut(s) 164
XapI RAATTY 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.