Rh7AG246000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0019038
Physical Location & Seq
Forward (+)
24281094 .. 24281721
628 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG246000.1

Sequence Viewer

Length: 192 bp
ATGAACTGGTCCGGGAATCACCGTCTACTTCGTCAAAATAGAGACCTTCCCAGCTTTAGGAGGGGATGTCAACTTCCTAGTCCAGGTAGGAATCACGAGAATCATTGTGAGGATGGGATAGACATTGCTGCATCCAACAGGATCCGGGCAGCTCTTGGGATGACCCCCTCGAGGGTGTTTCCTGTCGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.12

Weight (kDa)

11.1

Isoelectric Point (pI)

54.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019038)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr7g0209371 RchiOBHm_Chr7g0209411
rosa_multiflora Rmu_sc0035160.1_g000001 Rmu_sc0035161.1_g000001 Rmu_ssc0000038.1_g000014
rosa_samantha Rh7AG245900 Rh7AG246000 Rh7CG261500
rosa_wichuraiana Rw7G020820

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 169
AccI GTMKAC 1 cut(s) 25
AclWI GGATC 2 cut(s) 136, 149
AfiI CCNNNNNNNGG 4 cut(s) 57, 83, 171, 172
AjnI CCWGG 1 cut(s) 82
AluBI AGCT 2 cut(s) 54, 152
AluI AGCT 2 cut(s) 54, 152
Alw26I GTCTC 1 cut(s) 36
AlwI GGATC 2 cut(s) 136, 149
Ama87I CYCGRG 1 cut(s) 169
ApeKI GCWGC 2 cut(s) 128, 149
AspS9I GGNCC 1 cut(s) 9
AsuC2I CCSGG 2 cut(s) 13, 146
AsuHPI GGTGA 1 cut(s) 11
AvaI CYCGRG 1 cut(s) 169
AvaII GGWCC 1 cut(s) 9
BamHI GGATCC 1 cut(s) 141
BauI CACGAG 1 cut(s) 95
BbvI GCAGC 2 cut(s) 115, 161
BccI CCATC 1 cut(s) 107
BciT130I CCWGG 1 cut(s) 84
BcnI CCSGG 2 cut(s) 13, 146
BcoDI GTCTC 1 cut(s) 36
BfaI CTAG 1 cut(s) 78
BisI GCNGC 2 cut(s) 129, 150
BlsI GCNGC 2 cut(s) 130, 151
Bme1390I CCNGG 3 cut(s) 13, 84, 146
Bme18I GGWCC 1 cut(s) 9
BmeT110I CYCGRG 1 cut(s) 169
BmgT120I GGNCC 1 cut(s) 9
BmiI GGNNCC 1 cut(s) 143
BmrFI CCNGG 3 cut(s) 13, 84, 146
BmsI GCATC 1 cut(s) 140
BpuMI CCSGG 2 cut(s) 13, 146
BsaI GGTCTC 1 cut(s) 36
BsaXI ACNNNNNCTCC 2 cut(s) 52, 82
Bsc4I CCNNNNNNNGG 4 cut(s) 57, 83, 171, 172
Bse1I ACTGG 1 cut(s) 11
Bse3DI GCAATG 1 cut(s) 123
BseBI CCWGG 1 cut(s) 84
BseGI GGATG 4 cut(s) 71, 118, 131, 165
BseLI CCNNNNNNNGG 4 cut(s) 57, 83, 171, 172
BseMI GCAATG 1 cut(s) 123
BseNI ACTGG 1 cut(s) 11
BseXI GCAGC 2 cut(s) 115, 161
BseYI CCCAGC 1 cut(s) 50
BsiHKCI CYCGRG 1 cut(s) 169
BsiSI CCGG 2 cut(s) 12, 145
BslI CCNNNNNNNGG 4 cut(s) 57, 83, 171, 172
BsmAI GTCTC 1 cut(s) 36
Bso31I GGTCTC 1 cut(s) 36
BsoBI CYCGRG 1 cut(s) 169
Bsp143I GATC 1 cut(s) 141
BspLI GGNNCC 1 cut(s) 143
BspPI GGATC 2 cut(s) 136, 149
BspTNI GGTCTC 1 cut(s) 36
BsrDI GCAATG 1 cut(s) 123
BsrI ACTGG 1 cut(s) 11
BssMI GATC 1 cut(s) 141
BssSI CACGAG 1 cut(s) 95
Bst2BI CACGAG 1 cut(s) 95
Bst2UI CCWGG 1 cut(s) 84
Bst4CI ACNGT 1 cut(s) 23
BstENI CCTNNNNNAGG 1 cut(s) 81
BstF5I GGATG 4 cut(s) 71, 118, 131, 165
BstKTI GATC 1 cut(s) 144
BstMAI GTCTC 1 cut(s) 36
BstMBI GATC 1 cut(s) 141
BstNI CCWGG 1 cut(s) 84
BstSCI CCNGG 3 cut(s) 11, 82, 144
BstV1I GCAGC 2 cut(s) 115, 161
BstX2I RGATCY 1 cut(s) 141
BstYI RGATCY 1 cut(s) 141
BtsCI GGATG 4 cut(s) 71, 118, 131, 165
Cfr13I GGNCC 1 cut(s) 9
CviJI RGCY 2 cut(s) 54, 152
CviKI_1 RGCY 2 cut(s) 54, 152
DpnI GATC 1 cut(s) 143
DpnII GATC 1 cut(s) 141
Eco31I GGTCTC 1 cut(s) 36
Eco47I GGWCC 1 cut(s) 9
Eco88I CYCGRG 1 cut(s) 169
EcoNI CCTNNNNNAGG 1 cut(s) 81
EcoRII CCWGG 1 cut(s) 82
FaiI YATR 1 cut(s) 190
FblI GTMKAC 1 cut(s) 25
Fnu4HI GCNGC 2 cut(s) 129, 150
FokI GGATG 4 cut(s) 78, 118, 125, 172
Fsp4HI GCNGC 2 cut(s) 129, 150
FspBI CTAG 1 cut(s) 78
GluI GCNGC 2 cut(s) 129, 150
GsaI CCCAGC 1 cut(s) 54
HapII CCGG 2 cut(s) 12, 145
HincII GTYRAC 1 cut(s) 71
HindII GTYRAC 1 cut(s) 71
HinfI GANTC 3 cut(s) 16, 91, 100
HpaII CCGG 2 cut(s) 12, 145
HphI GGTGA 1 cut(s) 11
Hpy166II GTNNAC 2 cut(s) 26, 71
Hpy188III TCNNGA 1 cut(s) 95
Hpy8I GTNNAC 2 cut(s) 26, 71
HpyAV CCTTC 1 cut(s) 56
HpyCH4III ACNGT 1 cut(s) 23
HpyCH4V TGCA 1 cut(s) 131
Kzo9I GATC 1 cut(s) 141
LpnPI CCDG 6 cut(s) 25, 64, 69, 96, 124, 158
Lsp1109I GCAGC 2 cut(s) 115, 161
LweI GCATC 1 cut(s) 140
MaeI CTAG 1 cut(s) 78
MalI GATC 1 cut(s) 143
MboI GATC 1 cut(s) 141
MflI RGATCY 1 cut(s) 141
MmeI TCCRAC 1 cut(s) 159
MnlI CCTC 4 cut(s) 54, 103, 165, 178
MspI CCGG 2 cut(s) 12, 145
MspR9I CCNGG 3 cut(s) 13, 84, 146
MvaI CCWGG 1 cut(s) 84
NciI CCSGG 2 cut(s) 13, 146
NdeII GATC 1 cut(s) 141
NlaIV GGNNCC 1 cut(s) 143
PaeR7I CTCGAG 1 cut(s) 169
PfeI GAWTC 3 cut(s) 16, 91, 100
PfoI TCCNGGA 1 cut(s) 11
PkrI GCNGC 2 cut(s) 130, 151
Psp6I CCWGG 1 cut(s) 82
PspFI CCCAGC 1 cut(s) 50
PspGI CCWGG 1 cut(s) 82
PspN4I GGNNCC 1 cut(s) 143
PspPI GGNCC 1 cut(s) 9
PspXI VCTCGAGB 1 cut(s) 169
PsuI RGATCY 1 cut(s) 141
SatI GCNGC 2 cut(s) 129, 150
Sau3AI GATC 1 cut(s) 141
Sau96I GGNCC 1 cut(s) 9
ScrFI CCNGG 3 cut(s) 13, 84, 146
SetI ASST 4 cut(s) 48, 56, 88, 154
SfaNI GCATC 1 cut(s) 140
Sfr274I CTCGAG 1 cut(s) 169
SinI GGWCC 1 cut(s) 9
SlaI CTCGAG 1 cut(s) 169
SmlI CTYRAG 1 cut(s) 169
SmoI CTYRAG 1 cut(s) 169
SspMI CTAG 1 cut(s) 78
StyD4I CCNGG 3 cut(s) 11, 82, 144
TaaI ACNGT 1 cut(s) 23
TaqI TCGA 1 cut(s) 170
TfiI GAWTC 3 cut(s) 16, 91, 100
TseI GCWGC 2 cut(s) 128, 149
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 9
XagI CCTNNNNNAGG 1 cut(s) 81
XhoI CTCGAG 1 cut(s) 169
XmiI GTMKAC 1 cut(s) 25
XspI CTAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.