Rh7AG269400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0020579
Physical Location & Seq
Forward (+)
28076801 .. 28079933
3133 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG269400.1

Sequence Viewer

Length: 234 bp
ATGCCCTTCTGGTTTACCATTTGCAATAGCCTAGTGGTTGCTGGGAGTTCGTGTGCTATTTTTGATTCTTGGAAAGAATATTGTTCTGGATTTCATCTCTACGTTGCAAAATTAAGGGTGTGGTACTATAATGGGGGCCTGCAGCGATTGCAGACAAAGATGCTGGTGGATCCTCCTTATGTGGCCAGTGGTGCTGAAACTGTAGACCATACGGATGCGCCTAATGATGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.65

Weight (kDa)

5.39

Isoelectric Point (pI)

43.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020579)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0308841
rosa_roxburghii Rroxscaffold_6G00406130
rosa_samantha Rh7AG269400 Rh7CG288600
rosa_wichuraiana Rw0G011010 Rw2G012600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 204
AclWI GGATC 2 cut(s) 164, 177
AcoI YGGCCR 1 cut(s) 183
AfaI GTAC 1 cut(s) 125
AlwI GGATC 2 cut(s) 164, 177
AoxI GGCC 2 cut(s) 136, 183
ApeKI GCWGC 1 cut(s) 142
AspLEI GCGC 1 cut(s) 220
AspS9I GGNCC 1 cut(s) 136
BalI TGGCCA 1 cut(s) 185
BamHI GGATCC 1 cut(s) 169
BbvI GCAGC 1 cut(s) 154
BfaI CTAG 1 cut(s) 32
BfmI CTRYAG 2 cut(s) 140, 201
BisI GCNGC 1 cut(s) 143
BlsI GCNGC 1 cut(s) 144
BmgT120I GGNCC 1 cut(s) 136
BmiI GGNNCC 2 cut(s) 137, 171
BmsI GCATC 3 cut(s) 150, 205, 217
BsaXI ACNNNNNCTCC 2 cut(s) 37, 67
Bse1I ACTGG 1 cut(s) 186
BseGI GGATG 1 cut(s) 220
BseNI ACTGG 1 cut(s) 186
BseXI GCAGC 1 cut(s) 154
BseYI CCCAGC 1 cut(s) 41
BshFI GGCC 2 cut(s) 138, 185
BsnI GGCC 2 cut(s) 138, 185
Bsp143I GATC 1 cut(s) 169
BspANI GGCC 2 cut(s) 138, 185
BspLI GGNNCC 2 cut(s) 137, 171
BspMAI CTGCAG 1 cut(s) 144
BspPI GGATC 2 cut(s) 164, 177
BsrI ACTGG 1 cut(s) 186
BssMI GATC 1 cut(s) 169
Bst4CI ACNGT 1 cut(s) 202
BstAPI GCANNNNNTGC 1 cut(s) 148
BstC8I GCNNGC 1 cut(s) 140
BstF5I GGATG 1 cut(s) 220
BstHHI GCGC 1 cut(s) 220
BstKTI GATC 1 cut(s) 172
BstMBI GATC 1 cut(s) 169
BstMWI GCNNNNNNNGC 2 cut(s) 148, 191
BstSFI CTRYAG 2 cut(s) 140, 201
BstV1I GCAGC 1 cut(s) 154
BstX2I RGATCY 1 cut(s) 169
BstYI RGATCY 1 cut(s) 169
BsuRI GGCC 2 cut(s) 138, 185
BtsCI GGATG 1 cut(s) 220
BtsIMutI CAGTG 1 cut(s) 193
Cac8I GCNNGC 1 cut(s) 140
CfoI GCGC 1 cut(s) 220
Cfr13I GGNCC 1 cut(s) 136
Csp6I GTAC 1 cut(s) 124
CviJI RGCY 3 cut(s) 30, 138, 185
CviKI_1 RGCY 3 cut(s) 30, 138, 185
CviQI GTAC 1 cut(s) 124
DpnI GATC 1 cut(s) 171
DpnII GATC 1 cut(s) 169
EaeI YGGCCR 1 cut(s) 183
EcoO109I RGGNCCY 1 cut(s) 136
FaiI YATR 3 cut(s) 129, 180, 210
FblI GTMKAC 1 cut(s) 204
Fnu4HI GCNGC 1 cut(s) 143
FokI GGATG 1 cut(s) 227
Fsp4HI GCNGC 1 cut(s) 143
FspBI CTAG 1 cut(s) 32
GlaI GCGC 1 cut(s) 219
GluI GCNGC 1 cut(s) 143
GsaI CCCAGC 1 cut(s) 45
HaeIII GGCC 2 cut(s) 138, 185
HhaI GCGC 1 cut(s) 220
Hin6I GCGC 1 cut(s) 218
HinP1I GCGC 1 cut(s) 218
HinfI GANTC 1 cut(s) 65
Hpy166II GTNNAC 2 cut(s) 15, 205
Hpy188III TCNNGA 1 cut(s) 87
Hpy8I GTNNAC 2 cut(s) 15, 205
HpyAV CCTTC 1 cut(s) 16
HpyCH4III ACNGT 1 cut(s) 202
HpyCH4IV ACGT 1 cut(s) 102
HpyCH4V TGCA 4 cut(s) 24, 107, 142, 151
HpyF10VI GCNNNNNNNGC 2 cut(s) 148, 191
HpySE526I ACGT 1 cut(s) 102
HspAI GCGC 1 cut(s) 218
Kzo9I GATC 1 cut(s) 169
LpnPI CCDG 5 cut(s) 27, 72, 149, 152, 199
Lsp1109I GCAGC 1 cut(s) 154
LweI GCATC 3 cut(s) 150, 205, 217
MaeI CTAG 1 cut(s) 32
MaeII ACGT 1 cut(s) 102
MalI GATC 1 cut(s) 171
MboI GATC 1 cut(s) 169
MflI RGATCY 1 cut(s) 169
MlsI TGGCCA 1 cut(s) 185
MluCI AATT 1 cut(s) 110
MluNI TGGCCA 1 cut(s) 185
MnlI CCTC 1 cut(s) 183
Mox20I TGGCCA 1 cut(s) 185
MscI TGGCCA 1 cut(s) 185
MseI TTAA 2 cut(s) 113, 232
MslI CAYNNNNRTG 1 cut(s) 213
Msp20I TGGCCA 1 cut(s) 185
MwoI GCNNNNNNNGC 2 cut(s) 148, 191
NdeII GATC 1 cut(s) 169
NlaIV GGNNCC 2 cut(s) 137, 171
PfeI GAWTC 1 cut(s) 65
PkrI GCNGC 1 cut(s) 144
PspFI CCCAGC 1 cut(s) 41
PspN4I GGNNCC 2 cut(s) 137, 171
PspPI GGNCC 1 cut(s) 136
PstI CTGCAG 1 cut(s) 144
PsuI RGATCY 1 cut(s) 169
RsaI GTAC 1 cut(s) 125
RsaNI GTAC 1 cut(s) 124
RseI CAYNNNNRTG 1 cut(s) 213
SaqAI TTAA 2 cut(s) 113, 232
SatI GCNGC 1 cut(s) 143
Sau3AI GATC 1 cut(s) 169
Sau96I GGNCC 1 cut(s) 136
SetI ASST 1 cut(s) 105
SfaNI GCATC 3 cut(s) 150, 205, 217
SfcI CTRYAG 2 cut(s) 140, 201
SgeI CNNG 9 cut(s) 22, 44, 54, 63, 81, 99, 151, 176, 198
SmiMI CAYNNNNRTG 1 cut(s) 213
Sse9I AATT 1 cut(s) 110
SspI AATATT 1 cut(s) 80
SspMI CTAG 1 cut(s) 32
TaaI ACNGT 1 cut(s) 202
TaiI ACGT 1 cut(s) 105
TasI AATT 1 cut(s) 110
TfiI GAWTC 1 cut(s) 65
Tru1I TTAA 2 cut(s) 113, 232
Tru9I TTAA 2 cut(s) 113, 232
TscAI CASTG 1 cut(s) 193
TseI GCWGC 1 cut(s) 142
TspDTI ATGAA 1 cut(s) 83
TspGWI ACGGA 1 cut(s) 227
TspRI CASTG 1 cut(s) 193
XmiI GTMKAC 1 cut(s) 204
XspI CTAG 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.