Rh7AG361500

Structural maintenance of chromosomes protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Reverse (-)
46561008 .. 46562536
1529 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG361500.1

Sequence Viewer

Length: 231 bp
ATGACTGATGAAGAAGATGAGGACCCCGACCGCAAAGCACATAAAAAGCCATACCCACCAACCAAACCAGATGGGAAGAATGAAGCGGAAACTTACATGCTGAAAGAGTTGTCACTTCTAAAGTGGCAAGAGAAAGCCACAAAACTGGCTCATGAAGATACCTCTGCCAAAATGCTTGATCTACAGGAAAATATAACCAGCTTAGAAGAAAATCTGAACACCGATAGGTAA

Protein Analysis

76

Amino Acids

8.84

Weight (kDa)

4.74

Isoelectric Point (pI)

42.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018860)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g12090
rosa_chinensis RchiOBHm_Chr5g0008461
rosa_laevigata RLG00000031789
rosa_roxburghii Rroxscaffold_1G00065520
rosa_samantha Rh5AG085100 Rh5AG085600 Rh7AG361500 Rh7BG353000 Rh7CG380100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 31, 86
AluBI AGCT 1 cut(s) 201
AluI AGCT 1 cut(s) 201
AspS9I GGNCC 1 cut(s) 22
AvaII GGWCC 1 cut(s) 22
BccI CCATC 1 cut(s) 65
BfmI CTRYAG 1 cut(s) 182
Bme18I GGWCC 1 cut(s) 22
BmgT120I GGNCC 1 cut(s) 22
BmiI GGNNCC 1 cut(s) 24
Bse1I ACTGG 1 cut(s) 150
BseNI ACTGG 1 cut(s) 150
Bsh1285I CGRYCG 1 cut(s) 31
BsiEI CGRYCG 1 cut(s) 31
Bsp143I GATC 1 cut(s) 178
BspACI CCGC 2 cut(s) 31, 86
BspHI TCATGA 1 cut(s) 151
BspLI GGNNCC 1 cut(s) 24
BsrI ACTGG 1 cut(s) 150
BssMI GATC 1 cut(s) 178
BstDEI CTNAG 1 cut(s) 202
BstKTI GATC 1 cut(s) 181
BstMBI GATC 1 cut(s) 178
BstMCI CGRYCG 1 cut(s) 31
BstNSI RCATGY 1 cut(s) 100
BstSFI CTRYAG 1 cut(s) 182
BstXI CCANNNNNNTGG 1 cut(s) 145
CciI TCATGA 1 cut(s) 151
Cfr13I GGNCC 1 cut(s) 22
CviAII CATG 2 cut(s) 97, 152
CviJI RGCY 4 cut(s) 49, 137, 149, 201
CviKI_1 RGCY 4 cut(s) 49, 137, 149, 201
DdeI CTNAG 1 cut(s) 202
DpnI GATC 1 cut(s) 180
DpnII GATC 1 cut(s) 178
Eco47I GGWCC 1 cut(s) 22
EcoO109I RGGNCCY 1 cut(s) 22
FaeI CATG 2 cut(s) 100, 155
FaiI YATR 5 cut(s) 42, 52, 98, 153, 194
FatI CATG 2 cut(s) 96, 151
Hin1II CATG 2 cut(s) 100, 155
Hpy188I TCNGA 1 cut(s) 216
Hpy188III TCNNGA 1 cut(s) 152
HpyF3I CTNAG 1 cut(s) 202
Hsp92II CATG 2 cut(s) 100, 155
Kzo9I GATC 1 cut(s) 178
LpnPI CCDG 4 cut(s) 81, 131, 170, 211
MaeIII GTNAC 1 cut(s) 111
MalI GATC 1 cut(s) 180
MboI GATC 1 cut(s) 178
MboII GAAGA 5 cut(s) 23, 26, 88, 167, 218
MnlI CCTC 2 cut(s) 13, 172
NdeII GATC 1 cut(s) 178
NlaIII CATG 2 cut(s) 100, 155
NlaIV GGNNCC 1 cut(s) 24
NmuCI GTSAC 1 cut(s) 111
NspI RCATGY 1 cut(s) 100
PagI TCATGA 1 cut(s) 151
PpuMI RGGWCCY 1 cut(s) 22
Psp5II RGGWCCY 1 cut(s) 22
PspN4I GGNNCC 1 cut(s) 24
PspPI GGNCC 1 cut(s) 22
PspPPI RGGWCCY 1 cut(s) 22
Sau3AI GATC 1 cut(s) 178
Sau96I GGNCC 1 cut(s) 22
SetI ASST 3 cut(s) 164, 203, 230
SfcI CTRYAG 1 cut(s) 182
SgeI CNNG 9 cut(s) 38, 80, 109, 140, 158, 164, 188, 197, 210
SinI GGWCC 1 cut(s) 22
SsiI CCGC 2 cut(s) 31, 86
TseFI GTSAC 1 cut(s) 111
Tsp45I GTSAC 1 cut(s) 111
TspDTI ATGAA 3 cut(s) 24, 96, 168
VpaK11BI GGWCC 1 cut(s) 22
XceI RCATGY 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.