Rh7DG377300

Squamosa promoter-binding-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0021327
Physical Location & Seq
Forward (+)
51245306 .. 51246717
1412 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG377300.1

Sequence Viewer

Length: 264 bp
ATGGTTTCCAACATCTTTGAACCCAGTAGGCCTTCAGTTTCTGCCTCAAGCTTTAACCTTCCTCATTCCACCACAAGGTTACTATGTGCTCTAGAAGGGAAGTATCTGGCCCAAGAAGCTTGTGATGACGTGATGGATGGTGCTGATACAACTGTTGAGCATGATGAGCTACAGTGTATCAGATTCTCCTGCTCTATACCAAATGTTACTGGGCGAGGATTCATTGAGGTAATGCCATACGTTCATTTTGATTTCTATCTTTAA

Protein Analysis

87

Amino Acids

9.72

Weight (kDa)

4.56

Isoelectric Point (pI)

50.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ig_SPL7 PF26102 12 - 77 4.2e-20 SPL7-like, immunoglobulin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021327)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0333221 RchiOBHm_Chr7g0225661
rosa_multiflora Rmu_sc0001214.1_g000047
rosa_samantha Rh3CG372000 Rh7DG377300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 18
AfiI CCNNNNNNNGG 1 cut(s) 75
AgsI TTSAA 1 cut(s) 20
AjiI CACGTC 1 cut(s) 130
AluBI AGCT 3 cut(s) 51, 119, 169
AluI AGCT 3 cut(s) 51, 119, 169
Alw21I GWGCWC 1 cut(s) 91
AlwNI CAGNNNCTG 1 cut(s) 41
AoxI GGCC 2 cut(s) 29, 108
AspS9I GGNCC 1 cut(s) 109
BaeI ACNNNNGTAYC 2 cut(s) 138, 171
Bbv12I GWGCWC 1 cut(s) 91
BccI CCATC 2 cut(s) 127, 131
BfaI CTAG 1 cut(s) 92
BfmI CTRYAG 1 cut(s) 170
BmgBI CACGTC 1 cut(s) 130
BmgT120I GGNCC 1 cut(s) 109
BmrI ACTGGG 2 cut(s) 18, 219
BmuI ACTGGG 2 cut(s) 18, 219
BpuEI CTTGAG 1 cut(s) 31
BsaBI GATNNNNATC 1 cut(s) 255
Bsc4I CCNNNNNNNGG 1 cut(s) 75
Bse1I ACTGG 2 cut(s) 24, 214
Bse8I GATNNNNATC 1 cut(s) 255
BseGI GGATG 1 cut(s) 142
BseJI GATNNNNATC 1 cut(s) 255
BseLI CCNNNNNNNGG 1 cut(s) 75
BseNI ACTGG 2 cut(s) 24, 214
BshFI GGCC 2 cut(s) 31, 110
BsiHKAI GWGCWC 1 cut(s) 91
BslI CCNNNNNNNGG 1 cut(s) 75
BsnI GGCC 2 cut(s) 31, 110
Bsp1286I GDGCHC 1 cut(s) 91
BspANI GGCC 2 cut(s) 31, 110
BsrI ACTGG 2 cut(s) 24, 214
Bst4CI ACNGT 2 cut(s) 154, 174
BstF5I GGATG 1 cut(s) 142
BstMWI GCNNNNNNNGC 2 cut(s) 116, 166
BstSFI CTRYAG 1 cut(s) 170
BsuRI GGCC 2 cut(s) 31, 110
BtrI CACGTC 1 cut(s) 130
BtsCI GGATG 1 cut(s) 142
BtsIMutI CAGTG 1 cut(s) 179
CaiI CAGNNNCTG 1 cut(s) 41
Cfr13I GGNCC 1 cut(s) 109
CviAII CATG 1 cut(s) 161
CviJI RGCY 5 cut(s) 31, 51, 110, 119, 169
CviKI_1 RGCY 5 cut(s) 31, 51, 110, 119, 169
Eco147I AGGCCT 1 cut(s) 31
Eco57I CTGAAG 1 cut(s) 18
FaeI CATG 1 cut(s) 164
FaiI YATR 4 cut(s) 85, 162, 197, 238
FatI CATG 1 cut(s) 160
FokI GGATG 1 cut(s) 149
FspBI CTAG 1 cut(s) 92
HaeIII GGCC 2 cut(s) 31, 110
Hin1II CATG 1 cut(s) 164
HindIII AAGCTT 2 cut(s) 49, 117
HinfI GANTC 2 cut(s) 183, 219
Hpy188I TCNGA 1 cut(s) 182
Hpy188III TCNNGA 1 cut(s) 92
HpyAV CCTTC 3 cut(s) 42, 68, 89
HpyCH4III ACNGT 2 cut(s) 154, 174
HpyCH4IV ACGT 2 cut(s) 129, 240
HpyF10VI GCNNNNNNNGC 2 cut(s) 116, 166
HpySE526I ACGT 2 cut(s) 129, 240
Hsp92II CATG 1 cut(s) 164
LpnPI CCDG 4 cut(s) 37, 92, 195, 202
MaeI CTAG 1 cut(s) 92
MaeII ACGT 2 cut(s) 129, 240
MaeIII GTNAC 2 cut(s) 78, 205
MhlI GDGCHC 1 cut(s) 91
MmeI TCCRAC 1 cut(s) 33
MnlI CCTC 4 cut(s) 55, 72, 209, 220
MseI TTAA 2 cut(s) 54, 262
MwoI GCNNNNNNNGC 2 cut(s) 116, 166
NlaIII CATG 1 cut(s) 164
PceI AGGCCT 1 cut(s) 31
PfeI GAWTC 2 cut(s) 183, 219
PspPI GGNCC 1 cut(s) 109
PstNI CAGNNNCTG 1 cut(s) 41
SaqAI TTAA 2 cut(s) 54, 262
Sau96I GGNCC 1 cut(s) 109
SduI GDGCHC 1 cut(s) 91
SetI ASST 8 cut(s) 53, 60, 80, 121, 132, 171, 231, 243
SfcI CTRYAG 1 cut(s) 170
SmlI CTYRAG 1 cut(s) 46
SmoI CTYRAG 1 cut(s) 46
SseBI AGGCCT 1 cut(s) 31
SspMI CTAG 1 cut(s) 92
StuI AGGCCT 1 cut(s) 31
TaaI ACNGT 2 cut(s) 154, 174
TaiI ACGT 2 cut(s) 132, 243
TfiI GAWTC 2 cut(s) 183, 219
Tru1I TTAA 2 cut(s) 54, 262
Tru9I TTAA 2 cut(s) 54, 262
TscAI CASTG 1 cut(s) 179
TspDTI ATGAA 2 cut(s) 211, 233
TspRI CASTG 1 cut(s) 179
XbaI TCTAGA 1 cut(s) 91
XspI CTAG 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.