Rw1G008670

Acetolactate synthase small subunit 1, chloroplastic-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
OG0018922
Physical Location & Seq
Forward (+)
18917743 .. 18918536
794 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G008670.1

Sequence Viewer

Length: 261 bp
ATGTTAATAAAGATTGCTGTAAACACTACTGCTAGAAGGGATATTCTTGAAATTGCTGGCATTTTCCGTGCTAAAGCCGTTGATGTTTCTGATCACACAATTACTCTTGAGCTTACTGGCGATTTGAATAAAATTATTGCACTGCAGAAGTTACTAGAGCCCTATGGGCTTTGCGAGATTGCATGGACTGGGAGAATGGCATTGGAGCTCGGCTCTGGTGTGGATTCCACTTCTCTCCGTGGATATCCCCTTCCATTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00290 ko00650 ko00660 ko00770 ko01100 ko01110 ko01130 ko01210 ko01230 map00290 map00650 map00660 map00770 map01100 map01110 map01130 map01210 map01230
Pfam Domains
Protein Families
ACT ACT_5 ALS_ss_C

Protein Analysis

86

Amino Acids

9.37

Weight (kDa)

5.69

Isoelectric Point (pI)

24.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ALS_ss_C PF10369 1 - 69 2.9e-23 Small subunit of acetolactate synthase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018922)

Species Orthologous Gene IDs
pyrus_communis pycom02g00140
rosa_chinensis RchiOBHm_Chr5g0025461
rosa_multiflora Rmu_co8399419.1_g000001 Rmu_sc0000438.1_g000013 Rmu_sc0016852.1_g000007
rosa_samantha Rh5DG176900
rosa_wichuraiana Rw1G008670 Rw1G025300 Rw4G002960

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 259
AgsI TTSAA 2 cut(s) 50, 127
AluBI AGCT 2 cut(s) 112, 208
AluI AGCT 2 cut(s) 112, 208
Alw21I GWGCWC 1 cut(s) 210
BanII GRGCYC 2 cut(s) 162, 210
Bbv12I GWGCWC 1 cut(s) 210
BceAI ACGGC 1 cut(s) 62
BclI TGATCA 1 cut(s) 91
BfaI CTAG 2 cut(s) 33, 155
BfmI CTRYAG 1 cut(s) 143
BglI GCCNNNNNGGC 1 cut(s) 166
BmrI ACTGGG 1 cut(s) 198
BmuI ACTGGG 1 cut(s) 198
BplI GAGNNNNNCTC 2 cut(s) 197, 229
BpuEI CTTGAG 1 cut(s) 128
BsaJI CCNNGG 1 cut(s) 238
Bse1I ACTGG 2 cut(s) 121, 193
BseDI CCNNGG 1 cut(s) 238
BseNI ACTGG 2 cut(s) 121, 193
BsiHKAI GWGCWC 1 cut(s) 210
Bsp1286I GDGCHC 2 cut(s) 162, 210
Bsp143I GATC 1 cut(s) 91
BspMAI CTGCAG 1 cut(s) 147
BsrI ACTGG 2 cut(s) 121, 193
BssECI CCNNGG 1 cut(s) 238
BssMI GATC 1 cut(s) 91
BstC8I GCNNGC 1 cut(s) 58
BstDSI CCRYGG 1 cut(s) 238
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BstMWI GCNNNNNNNGC 1 cut(s) 166
BstSFI CTRYAG 1 cut(s) 143
BtgI CCRYGG 1 cut(s) 238
BtsI GCAGTG 1 cut(s) 140
BtsIMutI CAGTG 1 cut(s) 140
Cac8I GCNNGC 1 cut(s) 58
CviAII CATG 1 cut(s) 183
CviJI RGCY 6 cut(s) 77, 112, 160, 169, 208, 213
CviKI_1 RGCY 6 cut(s) 77, 112, 160, 169, 208, 213
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
Ecl136II GAGCTC 1 cut(s) 208
Eco24I GRGCYC 2 cut(s) 162, 210
Eco32I GATATC 1 cut(s) 245
Eco53kI GAGCTC 1 cut(s) 208
EcoICRI GAGCTC 1 cut(s) 208
EcoRV GATATC 1 cut(s) 245
EcoT38I GRGCYC 2 cut(s) 162, 210
FaeI CATG 1 cut(s) 186
FaiI YATR 3 cut(s) 165, 184, 259
FatI CATG 1 cut(s) 182
FbaI TGATCA 1 cut(s) 91
FriOI GRGCYC 2 cut(s) 162, 210
FspBI CTAG 2 cut(s) 33, 155
Hin1II CATG 1 cut(s) 186
HinfI GANTC 1 cut(s) 224
Hpy166II GTNNAC 1 cut(s) 22
Hpy188I TCNGA 1 cut(s) 91
Hpy188III TCNNGA 2 cut(s) 47, 107
Hpy8I GTNNAC 1 cut(s) 22
HpyAV CCTTC 2 cut(s) 30, 260
HpyCH4V TGCA 3 cut(s) 140, 145, 182
HpyF10VI GCNNNNNNNGC 1 cut(s) 166
Hsp92II CATG 1 cut(s) 186
Ksp22I TGATCA 1 cut(s) 91
Kzo9I GATC 1 cut(s) 91
LmnI GCTCC 1 cut(s) 205
LpnPI CCDG 4 cut(s) 42, 102, 174, 201
MaeI CTAG 2 cut(s) 33, 155
MaeIII GTNAC 1 cut(s) 150
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MhlI GDGCHC 2 cut(s) 162, 210
MluCI AATT 3 cut(s) 51, 99, 132
MseI TTAA 1 cut(s) 5
MwoI GCNNNNNNNGC 1 cut(s) 166
NdeII GATC 1 cut(s) 91
NlaIII CATG 1 cut(s) 186
NmeAIII GCCGAG 1 cut(s) 189
PfeI GAWTC 1 cut(s) 224
PsiI TTATAA 1 cut(s) 259
Psp124BI GAGCTC 1 cut(s) 210
PstI CTGCAG 1 cut(s) 147
SacI GAGCTC 1 cut(s) 210
SaqAI TTAA 1 cut(s) 5
Sau3AI GATC 1 cut(s) 91
SduI GDGCHC 2 cut(s) 162, 210
SetI ASST 2 cut(s) 114, 210
SfcI CTRYAG 1 cut(s) 143
SmlI CTYRAG 1 cut(s) 107
SmoI CTYRAG 1 cut(s) 107
Sse9I AATT 3 cut(s) 51, 99, 132
SspMI CTAG 2 cut(s) 33, 155
SstI GAGCTC 1 cut(s) 210
TasI AATT 3 cut(s) 51, 99, 132
TfiI GAWTC 1 cut(s) 224
Tru1I TTAA 1 cut(s) 5
Tru9I TTAA 1 cut(s) 5
TscAI CASTG 1 cut(s) 147
TspGWI ACGGA 2 cut(s) 56, 227
TspRI CASTG 1 cut(s) 147
XspI CTAG 2 cut(s) 33, 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.