Rw4G022800

Ubiquitin carboxyl-terminal hydrolase

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
Physical Location & Seq
Reverse (-)
48298914 .. 48300452
1539 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G022800.1

Sequence Viewer

Length: 282 bp
ATGCTGGAGACCAGAAATGGTATCTCTCCTTATCCTTCTTATATTCGTCCTTCTTTTCAACAAAAACAGAGGAGAAATGCTTATCTCTATCCCAAGGGATTTGGCAAAGGAAATGGTACTTATCTTTCTATTTTCTTGGCATTGGCTGATTGGAAACCAATTCCTCTTTGCCAAGTCGTTGTCGTGGGTTTGGCTCAGTTCATTAGTCTAAGCATTTTGGAGGCGGAGAAAGAGTTTTTGATGAAGAATACTTGCATTGTGGAGGCAGAGGTCATTGTCTAA

Protein Analysis

93

Amino Acids

10.51

Weight (kDa)

9.0

Isoelectric Point (pI)

22.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021288)

Species Orthologous Gene IDs
pyrus_communis pycom16g12240
rosa_chinensis RchiOBHm_Chr4g0425871
rosa_roxburghii Rroxscaffold_5G00369180
rosa_samantha Rh4CG282600
rosa_wichuraiana Rw4G022800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 224
AfaI GTAC 1 cut(s) 118
AgsI TTSAA 1 cut(s) 59
Alw26I GTCTC 1 cut(s) 2
BcoDI GTCTC 1 cut(s) 2
BpmI CTGGAG 1 cut(s) 26
BsaI GGTCTC 1 cut(s) 2
BsaJI CCNNGG 1 cut(s) 93
BsaXI ACNNNNNCTCC 2 cut(s) 218, 248
BseDI CCNNGG 1 cut(s) 93
BseMII CTCAG 1 cut(s) 209
BseRI GAGGAG 1 cut(s) 85
BsmAI GTCTC 1 cut(s) 2
Bso31I GGTCTC 1 cut(s) 2
BspACI CCGC 1 cut(s) 224
BspCNI CTCAG 1 cut(s) 208
BspTNI GGTCTC 1 cut(s) 2
BssECI CCNNGG 1 cut(s) 93
BssT1I CCWWGG 1 cut(s) 93
BstDEI CTNAG 2 cut(s) 195, 209
BstMAI GTCTC 1 cut(s) 2
Csp6I GTAC 1 cut(s) 117
CviJI RGCY 2 cut(s) 146, 194
CviKI_1 RGCY 2 cut(s) 146, 194
CviQI GTAC 1 cut(s) 117
DdeI CTNAG 2 cut(s) 195, 209
EciI GGCGGA 1 cut(s) 239
Eco130I CCWWGG 1 cut(s) 93
Eco31I GGTCTC 1 cut(s) 2
EcoT14I CCWWGG 1 cut(s) 93
ErhI CCWWGG 1 cut(s) 93
FaiI YATR 1 cut(s) 42
GsuI CTGGAG 1 cut(s) 26
HpyAV CCTTC 2 cut(s) 45, 60
HpyCH4V TGCA 1 cut(s) 255
HpyF3I CTNAG 2 cut(s) 195, 209
LpnPI CCDG 1 cut(s) 25
MboII GAAGA 1 cut(s) 256
MluCI AATT 1 cut(s) 159
MnlI CCTC 5 cut(s) 63, 174, 214, 256, 262
RsaI GTAC 1 cut(s) 118
RsaNI GTAC 1 cut(s) 117
SetI ASST 1 cut(s) 273
SgeI CNNG 7 cut(s) 17, 24, 106, 148, 185, 196, 264
Sse9I AATT 1 cut(s) 159
SsiI CCGC 1 cut(s) 224
StyI CCWWGG 1 cut(s) 93
TasI AATT 1 cut(s) 159
TspDTI ATGAA 2 cut(s) 190, 257
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.