Rw5G019180

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Reverse (-)
25001503 .. 25001979
477 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G019180.1

Sequence Viewer

Length: 309 bp
ATGGCTCTAGTTAGTAGCTTCATGCCAAAGATGACCATGGTCCAGATGTTTCCCACTAATTCCAAGCCTTGCATCCTGCAGAATAAGAACGTTGCAATTATAAGATGTGCTGTCAAAAGGCCAGGAATTAATACAGGGAGCCCTCCTCAGATCAACCAGGTACTTAGAGTCGCTGACCGGAGTTTGAGAACAGATCAGGTGGTTGGTCTCAGAAGATTGAATAATGGAGAAGATGGAAAAGCAAATGCAGGAAATACTGTTGTCGATGATGTTAGTAATACAACCAAGACTGCTGATGCTACTGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

11.01

Weight (kDa)

9.78

Isoelectric Point (pI)

41.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 101
AclI AACGTT 1 cut(s) 90
AfaI GTAC 1 cut(s) 162
AgsI TTSAA 1 cut(s) 220
AjnI CCWGG 2 cut(s) 121, 156
AluBI AGCT 1 cut(s) 18
AluI AGCT 1 cut(s) 18
Alw26I GTCTC 1 cut(s) 212
AoxI GGCC 1 cut(s) 119
AseI ATTAAT 1 cut(s) 129
AspS9I GGNCC 1 cut(s) 40
AvaII GGWCC 1 cut(s) 40
BanII GRGCYC 1 cut(s) 143
BccI CCATC 1 cut(s) 227
BciT130I CCWGG 2 cut(s) 123, 158
BcoDI GTCTC 1 cut(s) 212
BfaI CTAG 1 cut(s) 8
BfmI CTRYAG 1 cut(s) 77
Bme1390I CCNGG 2 cut(s) 123, 158
Bme18I GGWCC 1 cut(s) 40
BmgT120I GGNCC 1 cut(s) 40
BmiI GGNNCC 1 cut(s) 140
BmrFI CCNGG 2 cut(s) 123, 158
BmsI GCATC 2 cut(s) 81, 286
BoxI GACNNNNGTC 1 cut(s) 38
BplI GAGNNNNNCTC 2 cut(s) 130, 162
BsaI GGTCTC 1 cut(s) 212
BsaJI CCNNGG 1 cut(s) 36
BsaWI WCCGGW 1 cut(s) 177
BseBI CCWGG 2 cut(s) 123, 158
BseDI CCNNGG 1 cut(s) 36
BseGI GGATG 1 cut(s) 72
BseMII CTCAG 2 cut(s) 161, 223
BseRI GAGGAG 1 cut(s) 135
BshFI GGCC 1 cut(s) 121
BsiSI CCGG 1 cut(s) 178
BsmAI GTCTC 1 cut(s) 212
BsnI GGCC 1 cut(s) 121
Bso31I GGTCTC 1 cut(s) 212
Bsp1286I GDGCHC 1 cut(s) 143
Bsp143I GATC 2 cut(s) 150, 193
Bsp19I CCATGG 1 cut(s) 36
BspANI GGCC 1 cut(s) 121
BspCNI CTCAG 2 cut(s) 160, 222
BspLI GGNNCC 1 cut(s) 140
BspMAI CTGCAG 1 cut(s) 81
BspTNI GGTCTC 1 cut(s) 212
BssECI CCNNGG 1 cut(s) 36
BssMI GATC 2 cut(s) 150, 193
BssT1I CCWWGG 1 cut(s) 36
Bst2UI CCWGG 2 cut(s) 123, 158
Bst4CI ACNGT 1 cut(s) 259
BstDEI CTNAG 3 cut(s) 147, 164, 209
BstDSI CCRYGG 1 cut(s) 36
BstF5I GGATG 1 cut(s) 72
BstKTI GATC 2 cut(s) 153, 196
BstMAI GTCTC 1 cut(s) 212
BstMBI GATC 2 cut(s) 150, 193
BstNI CCWGG 2 cut(s) 123, 158
BstPAI GACNNNNGTC 1 cut(s) 38
BstSCI CCNGG 2 cut(s) 121, 156
BstSFI CTRYAG 1 cut(s) 77
BsuRI GGCC 1 cut(s) 121
BtgI CCRYGG 1 cut(s) 36
BtsCI GGATG 1 cut(s) 72
Cfr13I GGNCC 1 cut(s) 40
CsiI ACCWGGT 1 cut(s) 156
Csp6I GTAC 1 cut(s) 161
CviAII CATG 2 cut(s) 22, 37
CviJI RGCY 5 cut(s) 5, 18, 67, 121, 141
CviKI_1 RGCY 5 cut(s) 5, 18, 67, 121, 141
CviQI GTAC 1 cut(s) 161
DdeI CTNAG 3 cut(s) 147, 164, 209
DpnI GATC 2 cut(s) 152, 195
DpnII GATC 2 cut(s) 150, 193
Eco130I CCWWGG 1 cut(s) 36
Eco24I GRGCYC 1 cut(s) 143
Eco31I GGTCTC 1 cut(s) 212
Eco47I GGWCC 1 cut(s) 40
EcoRII CCWGG 2 cut(s) 121, 156
EcoT14I CCWWGG 1 cut(s) 36
EcoT38I GRGCYC 1 cut(s) 143
ErhI CCWWGG 1 cut(s) 36
FaeI CATG 2 cut(s) 25, 40
FaiI YATR 3 cut(s) 23, 38, 101
FatI CATG 2 cut(s) 21, 36
FokI GGATG 1 cut(s) 59
FriOI GRGCYC 1 cut(s) 143
FspBI CTAG 1 cut(s) 8
HaeIII GGCC 1 cut(s) 121
HapII CCGG 1 cut(s) 178
Hin1II CATG 2 cut(s) 25, 40
HinfI GANTC 1 cut(s) 168
HpaII CCGG 1 cut(s) 178
Hpy188I TCNGA 2 cut(s) 150, 212
Hpy188III TCNNGA 1 cut(s) 43
HpyCH4III ACNGT 1 cut(s) 259
HpyCH4IV ACGT 1 cut(s) 90
HpyCH4V TGCA 4 cut(s) 72, 79, 95, 248
HpyF3I CTNAG 3 cut(s) 147, 164, 209
HpySE526I ACGT 1 cut(s) 90
Hsp92II CATG 2 cut(s) 25, 40
Kzo9I GATC 2 cut(s) 150, 193
LmnI GCTCC 1 cut(s) 138
LweI GCATC 2 cut(s) 81, 286
MabI ACCWGGT 1 cut(s) 156
MaeI CTAG 1 cut(s) 8
MaeII ACGT 1 cut(s) 90
MalI GATC 2 cut(s) 152, 195
MboI GATC 2 cut(s) 150, 193
MboII GAAGA 2 cut(s) 225, 242
MhlI GDGCHC 1 cut(s) 143
MluCI AATT 3 cut(s) 58, 96, 126
MlyI GAGTC 1 cut(s) 177
MnlI CCTC 2 cut(s) 153, 156
MseI TTAA 2 cut(s) 129, 307
MspI CCGG 1 cut(s) 178
MspR9I CCNGG 2 cut(s) 123, 158
MvaI CCWGG 2 cut(s) 123, 158
NcoI CCATGG 1 cut(s) 36
NdeII GATC 2 cut(s) 150, 193
NlaIII CATG 2 cut(s) 25, 40
NlaIV GGNNCC 1 cut(s) 140
PleI GAGTC 1 cut(s) 176
PpsI GAGTC 1 cut(s) 176
PshAI GACNNNNGTC 1 cut(s) 38
PshBI ATTAAT 1 cut(s) 129
PsiI TTATAA 1 cut(s) 101
Psp1406I AACGTT 1 cut(s) 90
Psp6I CCWGG 2 cut(s) 121, 156
PspGI CCWGG 2 cut(s) 121, 156
PspN4I GGNNCC 1 cut(s) 140
PspPI GGNCC 1 cut(s) 40
PstI CTGCAG 1 cut(s) 81
RsaI GTAC 1 cut(s) 162
RsaNI GTAC 1 cut(s) 161
SaqAI TTAA 2 cut(s) 129, 307
Sau3AI GATC 2 cut(s) 150, 193
Sau96I GGNCC 1 cut(s) 40
SchI GAGTC 1 cut(s) 177
ScrFI CCNGG 2 cut(s) 123, 158
SduI GDGCHC 1 cut(s) 143
SetI ASST 4 cut(s) 20, 93, 162, 201
SexAI ACCWGGT 1 cut(s) 156
SfaNI GCATC 2 cut(s) 81, 286
SfcI CTRYAG 1 cut(s) 77
SinI GGWCC 1 cut(s) 40
Sse9I AATT 3 cut(s) 58, 96, 126
SspMI CTAG 1 cut(s) 8
StyD4I CCNGG 2 cut(s) 121, 156
StyI CCWWGG 1 cut(s) 36
TaaI ACNGT 1 cut(s) 259
TaiI ACGT 1 cut(s) 93
TaqI TCGA 1 cut(s) 264
TasI AATT 3 cut(s) 58, 96, 126
Tru1I TTAA 2 cut(s) 129, 307
Tru9I TTAA 2 cut(s) 129, 307
TspDTI ATGAA 1 cut(s) 10
VpaK11BI GGWCC 1 cut(s) 40
VspI ATTAAT 1 cut(s) 129
XspI CTAG 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.