AT1G05785

Vesicle transport protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0008997
Physical Location & Seq
Forward (+)
1730242 .. 1732657
2416 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G05785.7

Sequence Viewer

Length: 408 bp
ATGGTGTACGAAATAACTGAGCAAAAAAAAGTTGGGTTGGGCCTCATTGGTTTTGGTTTATCCTTTACGTTTCTCGGAGTCATCTTGTACTTTGACAGAGGTTTGCTCGCTCTAGGAAACTTATTCTGGTTGATAGGTGTTGGCCTTTTACTTGGTTGGCAGTCGACTTGGAGAGTATTTACAAATGTTAATAACTTGAGGGGGACTATCTGTTTCGTCCTTGGACTCTTTCTAATATTTGTACGTTGGCCCATTATCGGCATTATCTTGGAGATATACGGTGTCATTGTCCTATTCGGCGGATTTTGGTCAACAGTAAAGGCATTTCTTTCCCAGATTCCTTTTGTCGGATGGATAATACAGTATCCTCTCATGGTTCTTGAGCAACTTGTAAGAGGTGCTCGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Got1

Protein Analysis

135

Amino Acids

15.29

Weight (kDa)

9.65

Isoelectric Point (pI)

25.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Got1 PF04178 15 - 114 3e-11 Got1/Sft2-like family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 164
AciI CCGC 1 cut(s) 300
AfaI GTAC 3 cut(s) 8, 89, 243
AfiI CCNNNNNNNGG 2 cut(s) 257, 347
Alw21I GWGCWC 1 cut(s) 403
AoxI GGCC 3 cut(s) 40, 142, 248
AspS9I GGNCC 2 cut(s) 40, 249
Bbv12I GWGCWC 1 cut(s) 403
BccI CCATC 1 cut(s) 345
BciVI GTATCC 1 cut(s) 375
BfaI CTAG 1 cut(s) 113
BfuI GTATCC 1 cut(s) 375
BmgT120I GGNCC 2 cut(s) 40, 249
BplI GAGNNNNNCTC 2 cut(s) 90, 122
BpuEI CTTGAG 2 cut(s) 217, 401
BsaJI CCNNGG 1 cut(s) 220
Bsc4I CCNNNNNNNGG 2 cut(s) 257, 347
BseDI CCNNGG 1 cut(s) 220
BseGI GGATG 1 cut(s) 356
BseLI CCNNNNNNNGG 2 cut(s) 257, 347
BseMII CTCAG 1 cut(s) 9
BshFI GGCC 3 cut(s) 42, 144, 250
BsiHKAI GWGCWC 1 cut(s) 403
BslFI GGGAC 1 cut(s) 217
BslI CCNNNNNNNGG 2 cut(s) 257, 347
BsmFI GGGAC 1 cut(s) 217
BsnI GGCC 3 cut(s) 42, 144, 250
Bsp1286I GDGCHC 1 cut(s) 403
BspACI CCGC 1 cut(s) 300
BspANI GGCC 3 cut(s) 42, 144, 250
BspCNI CTCAG 1 cut(s) 10
BssECI CCNNGG 1 cut(s) 220
BssT1I CCWWGG 1 cut(s) 220
Bst4CI ACNGT 3 cut(s) 281, 316, 363
BstC8I GCNNGC 1 cut(s) 108
BstDEI CTNAG 1 cut(s) 18
BstF5I GGATG 1 cut(s) 356
BsuI GTATCC 1 cut(s) 375
BsuRI GGCC 3 cut(s) 42, 144, 250
BtsCI GGATG 1 cut(s) 356
Cac8I GCNNGC 1 cut(s) 108
Cfr13I GGNCC 2 cut(s) 40, 249
Csp6I GTAC 3 cut(s) 7, 88, 242
CviAII CATG 1 cut(s) 373
CviJI RGCY 3 cut(s) 42, 144, 250
CviKI_1 RGCY 3 cut(s) 42, 144, 250
CviQI GTAC 3 cut(s) 7, 88, 242
DdeI CTNAG 1 cut(s) 18
EciI GGCGGA 1 cut(s) 315
Eco130I CCWWGG 1 cut(s) 220
EcoT14I CCWWGG 1 cut(s) 220
ErhI CCWWGG 1 cut(s) 220
FaeI CATG 1 cut(s) 376
FaiI YATR 2 cut(s) 277, 374
FaqI GGGAC 1 cut(s) 217
FatI CATG 1 cut(s) 372
FblI GTMKAC 1 cut(s) 164
FokI GGATG 1 cut(s) 363
FspBI CTAG 1 cut(s) 113
HaeIII GGCC 3 cut(s) 42, 144, 250
Hin1II CATG 1 cut(s) 376
HincII GTYRAC 2 cut(s) 165, 312
HindII GTYRAC 2 cut(s) 165, 312
HinfI GANTC 3 cut(s) 78, 225, 337
Hpy166II GTNNAC 3 cut(s) 7, 165, 312
Hpy188I TCNGA 2 cut(s) 77, 350
Hpy188III TCNNGA 1 cut(s) 380
Hpy8I GTNNAC 3 cut(s) 7, 165, 312
HpyCH4III ACNGT 3 cut(s) 281, 316, 363
HpyCH4IV ACGT 2 cut(s) 68, 244
HpyF3I CTNAG 1 cut(s) 18
HpySE526I ACGT 2 cut(s) 68, 244
Hsp92II CATG 1 cut(s) 376
LpnPI CCDG 2 cut(s) 112, 347
MaeI CTAG 1 cut(s) 113
MaeII ACGT 2 cut(s) 68, 244
MhlI GDGCHC 1 cut(s) 403
MlyI GAGTC 2 cut(s) 87, 219
MmeI TCCRAC 1 cut(s) 328
MnlI CCTC 5 cut(s) 53, 92, 192, 378, 389
MseI TTAA 1 cut(s) 189
NlaIII CATG 1 cut(s) 376
PfeI GAWTC 1 cut(s) 337
PleI GAGTC 2 cut(s) 86, 219
PpsI GAGTC 2 cut(s) 86, 219
PspPI GGNCC 2 cut(s) 40, 249
RsaI GTAC 3 cut(s) 8, 89, 243
RsaNI GTAC 3 cut(s) 7, 88, 242
SalI GTCGAC 1 cut(s) 163
SaqAI TTAA 1 cut(s) 189
Sau96I GGNCC 2 cut(s) 40, 249
SchI GAGTC 2 cut(s) 87, 219
SduI GDGCHC 1 cut(s) 403
SetI ASST 5 cut(s) 71, 103, 139, 247, 400
SmlI CTYRAG 2 cut(s) 196, 380
SmoI CTYRAG 2 cut(s) 196, 380
SsiI CCGC 1 cut(s) 300
SspI AATATT 1 cut(s) 237
SspMI CTAG 1 cut(s) 113
StyI CCWWGG 1 cut(s) 220
TaaI ACNGT 3 cut(s) 281, 316, 363
TaiI ACGT 2 cut(s) 71, 247
TaqI TCGA 1 cut(s) 164
TatI WGTACW 1 cut(s) 87
TfiI GAWTC 1 cut(s) 337
Tru1I TTAA 1 cut(s) 189
Tru9I TTAA 1 cut(s) 189
XmiI GTMKAC 1 cut(s) 164
XspI CTAG 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.