FvH4_4g11700

Vesicle transport protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0008997
Physical Location & Seq
Reverse (-)
15406506 .. 15410820
4315 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g11700.t2

Sequence Viewer

Length: 345 bp
ATGGCTTATGAATTGACTGAGCAAAAAAAGGTTGGGTTGGGTCTTCTTGGGTTTGGCATCTTATTCACGTTTCTGGGTGTGGTGCTATTCTTCGACCGAGGTTTGCTTGCTCTTGGGAATATATTTTGGTTAAGTGGGGTGGCCCTGTTACTTGGTTGGCGTTCAACAGTTAATGTCTTCACTAGCAGAGCAAACGTAAAGGGTTCTGCATCTTTTCTGATTGGTCTCTTTTTCCTTTTCGTTCGGTGGCCAATCCTTGGCATAGTCTTGGAACTATATGGTTGTCTCGTTCTGTTCGGAGGAAGATCAATGCGTAGTCAAGTCTGCCTCGTGTGTTCGTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Got1

Protein Analysis

115

Amino Acids

12.52

Weight (kDa)

9.64

Isoelectric Point (pI)

42.45

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Got1 PF04178 15 - 102 2e-08 Got1/Sft2-like family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 257
AcoI YGGCCR 1 cut(s) 248
AfiI CCNNNNNNNGG 1 cut(s) 257
AgsI TTSAA 1 cut(s) 165
Alw26I GTCTC 2 cut(s) 230, 290
AoxI GGCC 2 cut(s) 141, 248
AspS9I GGNCC 1 cut(s) 142
BalI TGGCCA 1 cut(s) 250
BauI CACGAG 1 cut(s) 329
BbsI GAAGAC 2 cut(s) 35, 169
BcoDI GTCTC 2 cut(s) 230, 290
BfaI CTAG 1 cut(s) 183
BmgT120I GGNCC 1 cut(s) 142
BmsI GCATC 2 cut(s) 66, 218
BpiI GAAGAC 2 cut(s) 35, 169
BsaI GGTCTC 1 cut(s) 230
BsaJI CCNNGG 2 cut(s) 97, 256
Bsc4I CCNNNNNNNGG 1 cut(s) 257
BseDI CCNNGG 2 cut(s) 97, 256
BseLI CCNNNNNNNGG 1 cut(s) 257
BseMII CTCAG 1 cut(s) 9
Bsh1285I CGRYCG 1 cut(s) 97
BshFI GGCC 2 cut(s) 143, 250
BsiEI CGRYCG 1 cut(s) 97
BslI CCNNNNNNNGG 1 cut(s) 257
BsmAI GTCTC 2 cut(s) 230, 290
BsnI GGCC 2 cut(s) 143, 250
Bso31I GGTCTC 1 cut(s) 230
Bsp143I GATC 1 cut(s) 305
BspANI GGCC 2 cut(s) 143, 250
BspCNI CTCAG 1 cut(s) 10
BspTNI GGTCTC 1 cut(s) 230
BssECI CCNNGG 2 cut(s) 97, 256
BssMI GATC 1 cut(s) 305
BssSI CACGAG 1 cut(s) 329
BssT1I CCWWGG 1 cut(s) 256
Bst2BI CACGAG 1 cut(s) 329
Bst4CI ACNGT 1 cut(s) 169
BstC8I GCNNGC 1 cut(s) 108
BstDEI CTNAG 1 cut(s) 18
BstKTI GATC 1 cut(s) 308
BstMAI GTCTC 2 cut(s) 230, 290
BstMBI GATC 1 cut(s) 305
BstMCI CGRYCG 1 cut(s) 97
BstV2I GAAGAC 2 cut(s) 35, 169
BsuRI GGCC 2 cut(s) 143, 250
Cac8I GCNNGC 1 cut(s) 108
Cfr13I GGNCC 1 cut(s) 142
CviJI RGCY 3 cut(s) 5, 143, 250
CviKI_1 RGCY 3 cut(s) 5, 143, 250
DdeI CTNAG 1 cut(s) 18
DpnI GATC 1 cut(s) 307
DpnII GATC 1 cut(s) 305
EaeI YGGCCR 1 cut(s) 248
Eco130I CCWWGG 1 cut(s) 256
Eco31I GGTCTC 1 cut(s) 230
EcoT14I CCWWGG 1 cut(s) 256
ErhI CCWWGG 1 cut(s) 256
FaiI YATR 6 cut(s) 9, 122, 263, 277, 279, 343
FspBI CTAG 1 cut(s) 183
HaeIII GGCC 2 cut(s) 143, 250
Hpy188I TCNGA 2 cut(s) 219, 299
HpyCH4III ACNGT 1 cut(s) 169
HpyCH4IV ACGT 2 cut(s) 68, 195
HpyCH4V TGCA 1 cut(s) 209
HpyF3I CTNAG 1 cut(s) 18
HpySE526I ACGT 2 cut(s) 68, 195
Kzo9I GATC 1 cut(s) 305
LpnPI CCDG 2 cut(s) 59, 158
LweI GCATC 2 cut(s) 66, 218
MaeI CTAG 1 cut(s) 183
MaeII ACGT 2 cut(s) 68, 195
MaeIII GTNAC 1 cut(s) 147
MalI GATC 1 cut(s) 307
MboI GATC 1 cut(s) 305
MboII GAAGA 4 cut(s) 35, 82, 169, 315
MlsI TGGCCA 1 cut(s) 250
MluCI AATT 1 cut(s) 11
MluNI TGGCCA 1 cut(s) 250
MnlI CCTC 3 cut(s) 92, 293, 338
Mox20I TGGCCA 1 cut(s) 250
MscI TGGCCA 1 cut(s) 250
MseI TTAA 2 cut(s) 131, 171
Msp20I TGGCCA 1 cut(s) 250
NdeII GATC 1 cut(s) 305
PflMI CCANNNNNTGG 1 cut(s) 257
PspPI GGNCC 1 cut(s) 142
SaqAI TTAA 2 cut(s) 131, 171
Sau3AI GATC 1 cut(s) 305
Sau96I GGNCC 1 cut(s) 142
SetI ASST 4 cut(s) 33, 71, 103, 198
SfaNI GCATC 2 cut(s) 66, 218
Sse9I AATT 1 cut(s) 11
SspMI CTAG 1 cut(s) 183
StyI CCWWGG 1 cut(s) 256
TaaI ACNGT 1 cut(s) 169
TaiI ACGT 2 cut(s) 71, 198
TaqI TCGA 1 cut(s) 93
TaqII GACCGA 1 cut(s) 111
TasI AATT 1 cut(s) 11
Tru1I TTAA 2 cut(s) 131, 171
Tru9I TTAA 2 cut(s) 131, 171
TspDTI ATGAA 1 cut(s) 24
Van91I CCANNNNNTGG 1 cut(s) 257
XspI CTAG 1 cut(s) 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.