AT1G08005

protein phosphatase binding

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Forward (+)
2485281 .. 2485724
444 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G08005.1

Sequence Viewer

Length: 168 bp
ATGCCTGACGTCAAAACCGAATCTTTGATTCCAAACGGTTCAGAAAGATCCTTCTTTGATAAGGACGTGGAATTTGTGGGAGTGGAAGCACAAGTGACAGAGAAAGGCATGGAGCAAGCGATGAAGATGAACAAGGAGATGGCTGAGGACCTAAAGACTGAGGAATGA
Functional Annotation

Protein Analysis

55

Amino Acids

6.25

Weight (kDa)

4.43

Isoelectric Point (pI)

56.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 12
AclWI GGATC 1 cut(s) 42
AcsI RAATTY 1 cut(s) 71
AcyI GRCGYC 1 cut(s) 9
AjiI CACGTC 1 cut(s) 67
AlwI GGATC 1 cut(s) 42
ApoI RAATTY 1 cut(s) 71
ArsI GACNNNNNNTTYG 2 cut(s) 56, 88
AspS9I GGNCC 1 cut(s) 148
AvaII GGWCC 1 cut(s) 148
BbvCI CCTCAGC 1 cut(s) 144
BccI CCATC 1 cut(s) 133
Bme18I GGWCC 1 cut(s) 148
BmgBI CACGTC 1 cut(s) 67
BmgT120I GGNCC 1 cut(s) 148
Bpu10I CCTNAGC 1 cut(s) 144
BsaHI GRCGYC 1 cut(s) 9
BseMII CTCAG 2 cut(s) 135, 150
Bsp143I GATC 1 cut(s) 47
BspCNI CTCAG 2 cut(s) 136, 151
BspPI GGATC 1 cut(s) 42
BssMI GATC 1 cut(s) 47
BssNI GRCGYC 1 cut(s) 9
Bst4CI ACNGT 1 cut(s) 38
BstACI GRCGYC 1 cut(s) 9
BstC8I GCNNGC 1 cut(s) 117
BstDEI CTNAG 2 cut(s) 144, 159
BstKTI GATC 1 cut(s) 50
BstMBI GATC 1 cut(s) 47
BstX2I RGATCY 1 cut(s) 47
BstYI RGATCY 1 cut(s) 47
BtgZI GCGATG 1 cut(s) 134
BtrI CACGTC 1 cut(s) 67
Cac8I GCNNGC 1 cut(s) 117
Cfr13I GGNCC 1 cut(s) 148
CviAII CATG 1 cut(s) 109
CviJI RGCY 1 cut(s) 143
CviKI_1 RGCY 1 cut(s) 143
DdeI CTNAG 2 cut(s) 144, 159
DpnI GATC 1 cut(s) 49
DpnII GATC 1 cut(s) 47
Eco47I GGWCC 1 cut(s) 148
EcoO109I RGGNCCY 1 cut(s) 148
FaeI CATG 1 cut(s) 112
FaiI YATR 1 cut(s) 110
FatI CATG 1 cut(s) 108
Hin1I GRCGYC 1 cut(s) 9
Hin1II CATG 1 cut(s) 112
HinfI GANTC 2 cut(s) 20, 28
Hpy188I TCNGA 1 cut(s) 43
HpyAV CCTTC 1 cut(s) 61
HpyCH4III ACNGT 1 cut(s) 38
HpyCH4IV ACGT 2 cut(s) 9, 66
HpyF3I CTNAG 2 cut(s) 144, 159
HpySE526I ACGT 2 cut(s) 9, 66
Hsp92I GRCGYC 1 cut(s) 9
Hsp92II CATG 1 cut(s) 112
Kzo9I GATC 1 cut(s) 47
LmnI GCTCC 1 cut(s) 112
LpnPI CCDG 1 cut(s) 18
MaeII ACGT 2 cut(s) 9, 66
MaeIII GTNAC 1 cut(s) 94
MalI GATC 1 cut(s) 49
MboI GATC 1 cut(s) 47
MboII GAAGA 1 cut(s) 136
MflI RGATCY 1 cut(s) 47
MluCI AATT 1 cut(s) 71
MnlI CCTC 2 cut(s) 139, 154
NdeII GATC 1 cut(s) 47
NlaIII CATG 1 cut(s) 112
NmuCI GTSAC 1 cut(s) 94
PcsI WCGNNNNNNNCGW 1 cut(s) 15
PfeI GAWTC 2 cut(s) 20, 28
PpuMI RGGWCCY 1 cut(s) 148
Psp5II RGGWCCY 1 cut(s) 148
PspPI GGNCC 1 cut(s) 148
PspPPI RGGWCCY 1 cut(s) 148
PsuI RGATCY 1 cut(s) 47
Sau3AI GATC 1 cut(s) 47
Sau96I GGNCC 1 cut(s) 148
SetI ASST 3 cut(s) 12, 69, 153
SgeI CNNG 6 cut(s) 17, 79, 104, 121, 128, 145
SinI GGWCC 1 cut(s) 148
Sse9I AATT 1 cut(s) 71
TaaI ACNGT 1 cut(s) 38
TaiI ACGT 2 cut(s) 12, 69
TasI AATT 1 cut(s) 71
TfiI GAWTC 2 cut(s) 20, 28
TseFI GTSAC 1 cut(s) 94
Tsp45I GTSAC 1 cut(s) 94
TspDTI ATGAA 2 cut(s) 137, 143
VpaK11BI GGWCC 1 cut(s) 148
XapI RAATTY 1 cut(s) 71
ZraI GACGTC 1 cut(s) 10
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.