AT1G36380

Domain of unknown function (DUF4750)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0019621
Physical Location & Seq
Forward (+)
13700765 .. 13701632
868 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G36380.1

Sequence Viewer

Length: 255 bp
ATGGAATCATCTCCTTCGTTCCTTGACAATCTCTTCTTCTTCTTCCTCATACGTCCGCTTCTGGCGATCTCATTCGTCATCTGCTTCATCGCTCTTTGGTGGTTTCTAGCATGGAAGCTTGTATTAAGCCATGTTCCTCTAGTACAAGAGATCTTTGGCTTGAGGAAGAAAACCTTTATACCAAAACCTGAATCTCGTGGTCGAATCGCCAAATTCTACAAAAGTATCAGTTCTCAGAATCCTGTTCCCCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4750

Protein Analysis

84

Amino Acids

9.85

Weight (kDa)

10.13

Isoelectric Point (pI)

56.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF4750 PF15938 11 - 59 1e-23 Domain of unknown function (DUF4750)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019621)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G36380
fragaria_vesca FvH4_5g38460
malus_domestica MD15G1359700.v1.1
prunus_persica Prupe.1G507400_v2.0.a1
rosa_chinensis RchiOBHm_Chr7g0240501
rosa_roxburghii Rroxscaffold_3G00219930
rosa_wichuraiana Rw7G041150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 56
AcsI RAATTY 1 cut(s) 212
AfaI GTAC 1 cut(s) 144
AluBI AGCT 1 cut(s) 118
AluI AGCT 1 cut(s) 118
ApoI RAATTY 1 cut(s) 212
BaeI ACNNNNGTAYC 2 cut(s) 208, 241
BauI CACGAG 1 cut(s) 195
BfaI CTAG 2 cut(s) 107, 140
BglII AGATCT 1 cut(s) 150
BpuEI CTTGAG 1 cut(s) 181
BseMII CTCAG 1 cut(s) 248
Bsp143I GATC 2 cut(s) 66, 150
BspACI CCGC 1 cut(s) 56
BspCNI CTCAG 1 cut(s) 247
BssMI GATC 2 cut(s) 66, 150
BssSI CACGAG 1 cut(s) 195
Bst2BI CACGAG 1 cut(s) 195
Bst6I CTCTTC 1 cut(s) 38
BstDEI CTNAG 1 cut(s) 234
BstKTI GATC 2 cut(s) 69, 153
BstMBI GATC 2 cut(s) 66, 150
BstX2I RGATCY 1 cut(s) 150
BstYI RGATCY 1 cut(s) 150
BtgZI GCGATG 1 cut(s) 73
Csp6I GTAC 1 cut(s) 143
CviAII CATG 2 cut(s) 111, 131
CviJI RGCY 3 cut(s) 118, 129, 159
CviKI_1 RGCY 3 cut(s) 118, 129, 159
CviQI GTAC 1 cut(s) 143
DdeI CTNAG 1 cut(s) 234
DpnI GATC 2 cut(s) 68, 152
DpnII GATC 2 cut(s) 66, 150
Eam1104I CTCTTC 1 cut(s) 38
EarI CTCTTC 1 cut(s) 38
FaeI CATG 2 cut(s) 114, 134
FaiI YATR 4 cut(s) 50, 112, 132, 179
FalI AAGNNNNNCTT 2 cut(s) 158, 190
FatI CATG 2 cut(s) 110, 130
FspBI CTAG 2 cut(s) 107, 140
Hin1II CATG 2 cut(s) 114, 134
HindIII AAGCTT 1 cut(s) 116
HinfI GANTC 4 cut(s) 5, 191, 204, 238
Hpy188I TCNGA 1 cut(s) 237
HpyAV CCTTC 1 cut(s) 24
HpyCH4IV ACGT 1 cut(s) 52
HpyF3I CTNAG 1 cut(s) 234
HpySE526I ACGT 1 cut(s) 52
Hsp92II CATG 2 cut(s) 114, 134
Kzo9I GATC 2 cut(s) 66, 150
LpnPI CCDG 2 cut(s) 47, 201
MaeI CTAG 2 cut(s) 107, 140
MaeII ACGT 1 cut(s) 52
MalI GATC 2 cut(s) 68, 152
MboI GATC 2 cut(s) 66, 150
MboII GAAGA 5 cut(s) 25, 28, 31, 34, 178
MflI RGATCY 1 cut(s) 150
MluCI AATT 1 cut(s) 212
MnlI CCTC 3 cut(s) 56, 147, 156
MseI TTAA 1 cut(s) 125
NdeII GATC 2 cut(s) 66, 150
NlaIII CATG 2 cut(s) 114, 134
PfeI GAWTC 4 cut(s) 5, 191, 204, 238
PsuI RGATCY 1 cut(s) 150
RsaI GTAC 1 cut(s) 144
RsaNI GTAC 1 cut(s) 143
SaqAI TTAA 1 cut(s) 125
Sau3AI GATC 2 cut(s) 66, 150
SetI ASST 4 cut(s) 55, 120, 176, 190
SmlI CTYRAG 1 cut(s) 160
SmoI CTYRAG 1 cut(s) 160
Sse9I AATT 1 cut(s) 212
SsiI CCGC 1 cut(s) 56
SspMI CTAG 2 cut(s) 107, 140
TaiI ACGT 1 cut(s) 55
TaqI TCGA 1 cut(s) 202
TasI AATT 1 cut(s) 212
TatI WGTACW 1 cut(s) 142
TfiI GAWTC 4 cut(s) 5, 191, 204, 238
Tru1I TTAA 1 cut(s) 125
Tru9I TTAA 1 cut(s) 125
TspDTI ATGAA 1 cut(s) 76
XapI RAATTY 1 cut(s) 212
XspI CTAG 2 cut(s) 107, 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.