AT1G65000

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Forward (+)
24146925 .. 24148801
1877 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G65000.1

Sequence Viewer

Length: 252 bp
ATGGAGAAGAAGGAGATGGAGAAGTTGTGCCAAAGGTGCAAACAAAGCTACACAGATCTTTCAAACGAAACTTCCTCTTGCCGTTTTCATCCTTCCTTCTTCGTTTGTCGTCGTCACGATGACCAGAAAAGGTACTATGAATTGAAACCAGATGATCCACCGTATGCTGCCAAGTTCTATGATTGTTGCGGGGCAGAGGATCCTAATGCACCAGGTTGTGTCACAAACCCTCACATTTCATATGATGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

9.75

Weight (kDa)

5.54

Isoelectric Point (pI)

52.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013154)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 189
AclWI GGATC 3 cut(s) 149, 194, 207
AfaI GTAC 1 cut(s) 134
AgsI TTSAA 2 cut(s) 63, 145
AjnI CCWGG 1 cut(s) 211
AluBI AGCT 1 cut(s) 48
AluI AGCT 1 cut(s) 48
AlwI GGATC 3 cut(s) 149, 194, 207
ApeKI GCWGC 1 cut(s) 167
BamHI GGATCC 1 cut(s) 199
BbvI GCAGC 1 cut(s) 154
BccI CCATC 1 cut(s) 10
BceAI ACGGC 1 cut(s) 66
BciT130I CCWGG 1 cut(s) 213
BglII AGATCT 1 cut(s) 55
BisI GCNGC 1 cut(s) 168
BlsI GCNGC 1 cut(s) 169
Bme1390I CCNGG 1 cut(s) 213
BmiI GGNNCC 1 cut(s) 201
BmrFI CCNGG 1 cut(s) 213
BsaXI ACNNNNNCTCC 2 cut(s) 11, 41
BseBI CCWGG 1 cut(s) 213
BseGI GGATG 1 cut(s) 88
BseXI GCAGC 1 cut(s) 154
Bsp143I GATC 3 cut(s) 55, 154, 199
BspACI CCGC 1 cut(s) 189
BspLI GGNNCC 1 cut(s) 201
BspPI GGATC 3 cut(s) 149, 194, 207
BssMI GATC 3 cut(s) 55, 154, 199
Bst2UI CCWGG 1 cut(s) 213
Bst4CI ACNGT 1 cut(s) 162
BstF5I GGATG 1 cut(s) 88
BstKTI GATC 3 cut(s) 58, 157, 202
BstMBI GATC 3 cut(s) 55, 154, 199
BstMWI GCNNNNNNNGC 2 cut(s) 36, 45
BstNI CCWGG 1 cut(s) 213
BstSCI CCNGG 1 cut(s) 211
BstV1I GCAGC 1 cut(s) 154
BstX2I RGATCY 2 cut(s) 55, 199
BstYI RGATCY 2 cut(s) 55, 199
BtsCI GGATG 1 cut(s) 88
CsiI ACCWGGT 1 cut(s) 211
Csp6I GTAC 1 cut(s) 133
CviJI RGCY 1 cut(s) 48
CviKI_1 RGCY 1 cut(s) 48
CviQI GTAC 1 cut(s) 133
DpnI GATC 3 cut(s) 57, 156, 201
DpnII GATC 3 cut(s) 55, 154, 199
EcoRII CCWGG 1 cut(s) 211
FaiI YATR 5 cut(s) 138, 165, 180, 241, 243
FauI CCCGC 1 cut(s) 182
FauNDI CATATG 1 cut(s) 241
Fnu4HI GCNGC 1 cut(s) 168
FokI GGATG 1 cut(s) 75
Fsp4HI GCNGC 1 cut(s) 168
GluI GCNGC 1 cut(s) 168
Hpy188III TCNNGA 1 cut(s) 116
Hpy99I CGWCG 1 cut(s) 114
HpyAV CCTTC 3 cut(s) 4, 102, 106
HpyCH4III ACNGT 1 cut(s) 162
HpyCH4V TGCA 2 cut(s) 39, 209
HpyF10VI GCNNNNNNNGC 2 cut(s) 36, 45
Kzo9I GATC 3 cut(s) 55, 154, 199
LpnPI CCDG 4 cut(s) 137, 162, 198, 225
Lsp1109I GCAGC 1 cut(s) 154
MabI ACCWGGT 1 cut(s) 211
MaeIII GTNAC 2 cut(s) 113, 220
MalI GATC 3 cut(s) 57, 156, 201
MboI GATC 3 cut(s) 55, 154, 199
MboII GAAGA 2 cut(s) 19, 91
MflI RGATCY 2 cut(s) 55, 199
MluCI AATT 1 cut(s) 140
MnlI CCTC 3 cut(s) 85, 190, 240
MspR9I CCNGG 1 cut(s) 213
MvaI CCWGG 1 cut(s) 213
MwoI GCNNNNNNNGC 2 cut(s) 36, 45
NdeI CATATG 1 cut(s) 241
NdeII GATC 3 cut(s) 55, 154, 199
NlaIV GGNNCC 1 cut(s) 201
NmuCI GTSAC 2 cut(s) 113, 220
PkrI GCNGC 1 cut(s) 169
Psp6I CCWGG 1 cut(s) 211
PspGI CCWGG 1 cut(s) 211
PspN4I GGNNCC 1 cut(s) 201
PsuI RGATCY 2 cut(s) 55, 199
RsaI GTAC 1 cut(s) 134
RsaNI GTAC 1 cut(s) 133
SatI GCNGC 1 cut(s) 168
Sau3AI GATC 3 cut(s) 55, 154, 199
ScrFI CCNGG 1 cut(s) 213
SetI ASST 4 cut(s) 38, 50, 134, 217
SexAI ACCWGGT 1 cut(s) 211
SgeI CNNG 8 cut(s) 90, 128, 136, 161, 184, 202, 224, 225
Sse9I AATT 1 cut(s) 140
SsiI CCGC 1 cut(s) 189
StyD4I CCNGG 1 cut(s) 211
TaaI ACNGT 1 cut(s) 162
TasI AATT 1 cut(s) 140
TseFI GTSAC 2 cut(s) 113, 220
TseI GCWGC 1 cut(s) 167
Tsp45I GTSAC 2 cut(s) 113, 220
TspDTI ATGAA 3 cut(s) 77, 153, 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.