MD06G1024400.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
OG0013154
Physical Location & Seq
Reverse (-)
2995120 .. 2995389
270 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1024400.v1.1.491

Sequence Viewer

Length: 270 bp
ATGAAAAAAAAAAGTGGGAGTGAGGAGGATAAGGGAAAGGTATGCAAAAGGTGCAAGGAAAGCTACAGAGCCTCTTCTAACACCTTTTTCTTATGCCGCTTCCACCCTTCTTTCTTCGTCTGTCGCCTTCACGACGACCAAAAAAGGTACTATGAATTGGGACCCAACGATCCGCCATACGCTGCTAAGTTCTACGACTGTTGTGGGGCTGATGATCCTGAGGCATATGGTTGCACTACCAGTTTCTATGTTTCGTATGACGACGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.33

Weight (kDa)

6.08

Isoelectric Point (pI)

46.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013154)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G65000
fragaria_vesca FvH4_7g34150
malus_domestica MD01G1238100.v1.1 MD01G1238400.v1.1 MD06G1024400.v1.1
prunus_persica Prupe.2G328300_v2.0.a1
pyrus_communis pycom01g24560 pycom01g24600
rosa_chinensis RchiOBHm_Chr1g0384511 RchiOBHm_Chr2g0135851
rosa_multiflora Rmu_sc0007848.1_g000009
rosa_roxburghii Rroxscaffold_4G00276640
rosa_samantha Rh1AG473600 Rh1BG431700 Rh1CG444800 Rh1DG464200 Rh2BG384500
rosa_wichuraiana Rw1G039900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 97, 173
AclWI GGATC 2 cut(s) 164, 209
AfaI GTAC 1 cut(s) 149
AluBI AGCT 1 cut(s) 63
AluI AGCT 1 cut(s) 63
AlwI GGATC 2 cut(s) 164, 209
ApeKI GCWGC 1 cut(s) 182
AspS9I GGNCC 1 cut(s) 161
AvaII GGWCC 1 cut(s) 161
AxyI CCTNAGG 1 cut(s) 219
BbvI GCAGC 1 cut(s) 169
BfmI CTRYAG 1 cut(s) 64
BisI GCNGC 2 cut(s) 97, 183
BlsI GCNGC 2 cut(s) 98, 184
Bme18I GGWCC 1 cut(s) 161
BmgT120I GGNCC 1 cut(s) 161
BmiI GGNNCC 2 cut(s) 162, 163
Bse1I ACTGG 1 cut(s) 240
Bse21I CCTNAGG 1 cut(s) 219
BseMII CTCAG 1 cut(s) 210
BseNI ACTGG 1 cut(s) 240
BseRI GAGGAG 1 cut(s) 38
BseXI GCAGC 1 cut(s) 169
BslFI GGGAC 1 cut(s) 174
BsmFI GGGAC 1 cut(s) 174
Bsp143I GATC 2 cut(s) 169, 214
BspACI CCGC 2 cut(s) 97, 173
BspCNI CTCAG 1 cut(s) 211
BspLI GGNNCC 2 cut(s) 162, 163
BspPI GGATC 2 cut(s) 164, 209
BsrI ACTGG 1 cut(s) 240
BssMI GATC 2 cut(s) 169, 214
Bst4CI ACNGT 1 cut(s) 200
Bst6I CTCTTC 1 cut(s) 79
BstAPI GCANNNNNTGC 1 cut(s) 51
BstDEI CTNAG 2 cut(s) 186, 219
BstKTI GATC 2 cut(s) 172, 217
BstMBI GATC 2 cut(s) 169, 214
BstMWI GCNNNNNNNGC 2 cut(s) 51, 60
BstSFI CTRYAG 1 cut(s) 64
BstV1I GCAGC 1 cut(s) 169
Bsu36I CCTNAGG 1 cut(s) 219
Cfr13I GGNCC 1 cut(s) 161
Csp6I GTAC 1 cut(s) 148
CviJI RGCY 3 cut(s) 63, 71, 209
CviKI_1 RGCY 3 cut(s) 63, 71, 209
CviQI GTAC 1 cut(s) 148
DdeI CTNAG 2 cut(s) 186, 219
DpnI GATC 2 cut(s) 171, 216
DpnII GATC 2 cut(s) 169, 214
Eam1104I CTCTTC 1 cut(s) 79
EarI CTCTTC 1 cut(s) 79
EciI GGCGGA 1 cut(s) 162
Eco47I GGWCC 1 cut(s) 161
Eco81I CCTNAGG 1 cut(s) 219
EcoO109I RGGNCCY 1 cut(s) 161
FaiI YATR 8 cut(s) 43, 94, 153, 178, 226, 228, 249, 258
FaqI GGGAC 1 cut(s) 174
FauNDI CATATG 1 cut(s) 226
Fnu4HI GCNGC 2 cut(s) 97, 183
Fsp4HI GCNGC 2 cut(s) 97, 183
GluI GCNGC 2 cut(s) 97, 183
Hpy188III TCNNGA 2 cut(s) 131, 218
Hpy99I CGWCG 2 cut(s) 137, 266
HpyAV CCTTC 2 cut(s) 117, 137
HpyCH4III ACNGT 1 cut(s) 200
HpyCH4V TGCA 3 cut(s) 45, 54, 234
HpyF10VI GCNNNNNNNGC 2 cut(s) 51, 60
HpyF3I CTNAG 2 cut(s) 186, 219
KflI GGGWCCC 1 cut(s) 161
Kzo9I GATC 2 cut(s) 169, 214
LpnPI CCDG 2 cut(s) 231, 253
Lsp1109I GCAGC 1 cut(s) 169
MalI GATC 2 cut(s) 171, 216
MboI GATC 2 cut(s) 169, 214
MboII GAAGA 2 cut(s) 66, 106
MluCI AATT 1 cut(s) 155
MnlI CCTC 4 cut(s) 16, 19, 82, 214
MseI TTAA 1 cut(s) 268
MwoI GCNNNNNNNGC 2 cut(s) 51, 60
NdeI CATATG 1 cut(s) 226
NdeII GATC 2 cut(s) 169, 214
NlaIV GGNNCC 2 cut(s) 162, 163
PkrI GCNGC 2 cut(s) 98, 184
PpuMI RGGWCCY 1 cut(s) 161
Psp5II RGGWCCY 1 cut(s) 161
PspN4I GGNNCC 2 cut(s) 162, 163
PspPI GGNCC 1 cut(s) 161
PspPPI RGGWCCY 1 cut(s) 161
RsaI GTAC 1 cut(s) 149
RsaNI GTAC 1 cut(s) 148
SaqAI TTAA 1 cut(s) 268
SatI GCNGC 2 cut(s) 97, 183
Sau3AI GATC 2 cut(s) 169, 214
Sau96I GGNCC 1 cut(s) 161
SetI ASST 5 cut(s) 42, 53, 65, 86, 149
SfcI CTRYAG 1 cut(s) 64
SgeI CNNG 4 cut(s) 67, 143, 230, 252
SinI GGWCC 1 cut(s) 161
Sse9I AATT 1 cut(s) 155
SsiI CCGC 2 cut(s) 97, 173
TaaI ACNGT 1 cut(s) 200
TasI AATT 1 cut(s) 155
TauI GCSGC 1 cut(s) 99
Tru1I TTAA 1 cut(s) 268
Tru9I TTAA 1 cut(s) 268
TseI GCWGC 1 cut(s) 182
TspDTI ATGAA 2 cut(s) 17, 168
VpaK11BI GGWCC 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.