Rmu_sc0007848.1_g000009

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007848.1
Physical Location & Seq
Reverse (-)
54648 .. 54890
243 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007848.1_g000009.1.cds

Sequence Viewer

Length: 243 bp
atggagaagacgagaaagagtgagggcgagaagatatgcaaacaaagttatagtccatcttccaacaccacatcctcataccgcttccatccttctttcttcatcagtcgcctttatgacgaccagaaaaggtataatgaattgggacatgaagatcagccatatgctaccaagttctataactgttgtggggctgaggctcttgaaggttctggttgcagcaccagtttccatgtttcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

9.15

Weight (kDa)

6.81

Isoelectric Point (pI)

49.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013154)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 82
AgsI TTSAA 1 cut(s) 206
ApeKI GCWGC 1 cut(s) 219
ArsI GACNNNNNNTTYG 2 cut(s) 37, 69
BbsI GAAGAC 1 cut(s) 14
BbvCI CCTCAGC 1 cut(s) 195
BbvI GCAGC 1 cut(s) 231
BccI CCATC 2 cut(s) 64, 96
BisI GCNGC 1 cut(s) 220
BlsI GCNGC 1 cut(s) 221
BpiI GAAGAC 1 cut(s) 14
Bpu10I CCTNAGC 1 cut(s) 195
Bse1I ACTGG 1 cut(s) 225
BseGI GGATG 2 cut(s) 71, 88
BseMII CTCAG 1 cut(s) 186
BseNI ACTGG 1 cut(s) 225
BseXI GCAGC 1 cut(s) 231
BslFI GGGAC 1 cut(s) 159
BsmFI GGGAC 1 cut(s) 159
Bsp143I GATC 1 cut(s) 154
BspACI CCGC 1 cut(s) 82
BspCNI CTCAG 1 cut(s) 187
BsrI ACTGG 1 cut(s) 225
BssMI GATC 1 cut(s) 154
Bst4CI ACNGT 1 cut(s) 185
BstDEI CTNAG 1 cut(s) 195
BstF5I GGATG 2 cut(s) 71, 88
BstKTI GATC 1 cut(s) 157
BstMBI GATC 1 cut(s) 154
BstV1I GCAGC 1 cut(s) 231
BstV2I GAAGAC 1 cut(s) 14
BtsCI GGATG 2 cut(s) 71, 88
CviAII CATG 2 cut(s) 149, 233
CviJI RGCY 3 cut(s) 160, 194, 200
CviKI_1 RGCY 3 cut(s) 160, 194, 200
DdeI CTNAG 1 cut(s) 195
DpnI GATC 1 cut(s) 156
DpnII GATC 1 cut(s) 154
FaeI CATG 2 cut(s) 152, 236
FaqI GGGAC 1 cut(s) 159
FatI CATG 2 cut(s) 148, 232
FauNDI CATATG 1 cut(s) 163
Fnu4HI GCNGC 1 cut(s) 220
FokI GGATG 2 cut(s) 58, 75
Fsp4HI GCNGC 1 cut(s) 220
GluI GCNGC 1 cut(s) 220
Hin1II CATG 2 cut(s) 152, 236
Hpy188III TCNNGA 1 cut(s) 203
HpyAV CCTTC 2 cut(s) 102, 200
HpyCH4III ACNGT 1 cut(s) 185
HpyCH4V TGCA 2 cut(s) 39, 219
HpyF3I CTNAG 1 cut(s) 195
Hsp92II CATG 2 cut(s) 152, 236
Kzo9I GATC 1 cut(s) 154
LpnPI CCDG 3 cut(s) 137, 198, 238
Lsp1109I GCAGC 1 cut(s) 231
MalI GATC 1 cut(s) 156
MboI GATC 1 cut(s) 154
MboII GAAGA 5 cut(s) 19, 43, 51, 91, 164
MluCI AATT 1 cut(s) 140
MmeI TCCRAC 1 cut(s) 87
MnlI CCTC 3 cut(s) 16, 85, 190
MseI TTAA 1 cut(s) 241
NdeI CATATG 1 cut(s) 163
NdeII GATC 1 cut(s) 154
NlaIII CATG 2 cut(s) 152, 236
PkrI GCNGC 1 cut(s) 221
SaqAI TTAA 1 cut(s) 241
SatI GCNGC 1 cut(s) 220
Sau3AI GATC 1 cut(s) 154
SetI ASST 2 cut(s) 134, 211
SgeI CNNG 8 cut(s) 24, 40, 136, 161, 184, 215, 225, 237
Sse9I AATT 1 cut(s) 140
SsiI CCGC 1 cut(s) 82
TaaI ACNGT 1 cut(s) 185
TasI AATT 1 cut(s) 140
Tru1I TTAA 1 cut(s) 241
Tru9I TTAA 1 cut(s) 241
TseI GCWGC 1 cut(s) 219
TspDTI ATGAA 3 cut(s) 91, 153, 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.