AT2G31490

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
Physical Location & Seq
Forward (+)
13411940 .. 13413285
1346 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G31490.1

Sequence Viewer

Length: 216 bp
ATGGGTGGAGGAATGGAAACGAACAAGAACAAGTTCATCGAGGACTGGGGATCTGCTAGAGAGAATCTCGAGCACAATTTCCGCTGGACTCGTCGTAACTTCGCTCTCATCGGAATCTTCGGCATCGCTCTCCCGATCATTGTCTACAAGGGAATCGTCAAAGATTTCCATATGCAAGATGAAGATGCAGGCAGACCACACAGAAAGTTCCTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.29

Weight (kDa)

9.3

Isoelectric Point (pI)

39.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012012)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 144
AciI CCGC 1 cut(s) 82
AclWI GGATC 1 cut(s) 58
Alw21I GWGCWC 1 cut(s) 75
AlwI GGATC 1 cut(s) 58
Ama87I CYCGRG 1 cut(s) 68
Asp700I GAANNNNTTC 1 cut(s) 32
AvaI CYCGRG 1 cut(s) 68
Bbv12I GWGCWC 1 cut(s) 75
BfaI CTAG 1 cut(s) 57
BmeT110I CYCGRG 1 cut(s) 68
BmrI ACTGGG 1 cut(s) 55
BmsI GCATC 2 cut(s) 132, 175
BmuI ACTGGG 1 cut(s) 55
BplI GAGNNNNNCTC 2 cut(s) 51, 83
Bse1I ACTGG 1 cut(s) 50
BseNI ACTGG 1 cut(s) 50
BsiHKAI GWGCWC 1 cut(s) 75
BsiHKCI CYCGRG 1 cut(s) 68
BsoBI CYCGRG 1 cut(s) 68
Bsp1286I GDGCHC 1 cut(s) 75
Bsp143I GATC 2 cut(s) 50, 135
BspACI CCGC 1 cut(s) 82
BspPI GGATC 1 cut(s) 58
BsrI ACTGG 1 cut(s) 50
BssMI GATC 2 cut(s) 50, 135
BstC8I GCNNGC 1 cut(s) 190
BstKTI GATC 2 cut(s) 53, 138
BstMBI GATC 2 cut(s) 50, 135
BstX2I RGATCY 1 cut(s) 50
BstYI RGATCY 1 cut(s) 50
BtgZI GCGATG 1 cut(s) 109
Cac8I GCNNGC 1 cut(s) 190
DpnI GATC 2 cut(s) 52, 137
DpnII GATC 2 cut(s) 50, 135
Eco88I CYCGRG 1 cut(s) 68
FaiI YATR 2 cut(s) 171, 173
FauNDI CATATG 1 cut(s) 171
FblI GTMKAC 1 cut(s) 144
FspBI CTAG 1 cut(s) 57
HinfI GANTC 4 cut(s) 64, 88, 114, 153
Hpy166II GTNNAC 1 cut(s) 145
Hpy188I TCNGA 2 cut(s) 113, 215
Hpy188III TCNNGA 2 cut(s) 68, 133
Hpy8I GTNNAC 1 cut(s) 145
Hpy99I CGWCG 1 cut(s) 96
HpyCH4V TGCA 2 cut(s) 175, 188
Kzo9I GATC 2 cut(s) 50, 135
LpnPI CCDG 3 cut(s) 31, 70, 174
LweI GCATC 2 cut(s) 132, 175
MaeI CTAG 1 cut(s) 57
MaeIII GTNAC 1 cut(s) 95
MalI GATC 2 cut(s) 52, 137
MboI GATC 2 cut(s) 50, 135
MboII GAAGA 2 cut(s) 109, 194
MflI RGATCY 1 cut(s) 50
MhlI GDGCHC 1 cut(s) 75
MluCI AATT 1 cut(s) 76
MlyI GAGTC 1 cut(s) 82
MnlI CCTC 1 cut(s) 34
MroXI GAANNNNTTC 1 cut(s) 32
MspA1I CMGCKG 1 cut(s) 84
NdeI CATATG 1 cut(s) 171
NdeII GATC 2 cut(s) 50, 135
PaeR7I CTCGAG 1 cut(s) 68
PdmI GAANNNNTTC 1 cut(s) 32
PfeI GAWTC 3 cut(s) 64, 114, 153
PleI GAGTC 1 cut(s) 82
PpsI GAGTC 1 cut(s) 82
PsuI RGATCY 1 cut(s) 50
Sau3AI GATC 2 cut(s) 50, 135
SchI GAGTC 1 cut(s) 82
SduI GDGCHC 1 cut(s) 75
SfaNI GCATC 2 cut(s) 132, 175
Sfr274I CTCGAG 1 cut(s) 68
SlaI CTCGAG 1 cut(s) 68
SmlI CTYRAG 1 cut(s) 68
SmoI CTYRAG 1 cut(s) 68
Sse9I AATT 1 cut(s) 76
SsiI CCGC 1 cut(s) 82
SspMI CTAG 1 cut(s) 57
TaqI TCGA 2 cut(s) 39, 69
TasI AATT 1 cut(s) 76
TfiI GAWTC 3 cut(s) 64, 114, 153
TspDTI ATGAA 2 cut(s) 25, 195
XhoI CTCGAG 1 cut(s) 68
XmiI GTMKAC 1 cut(s) 144
XmnI GAANNNNTTC 1 cut(s) 32
XspI CTAG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.