Rmu_sc0003773.1_g000025

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003773.1
Physical Location & Seq
Reverse (-)
76165 .. 78511
2347 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003773.1_g000025.1.cds

Sequence Viewer

Length: 216 bp
atgggaggaggaatggaggcaaacaagaacaggttcgtggaggagtggggcgcggccagagaaaatctcgagcacaacttccggtggactcgccgcaacttcgccatcatcggaatcttcggcattgctatccccgtcctagtctacaagggcatcgtccgagaattccatatgcaagatgaggatgcaggcagaccatacaggaagtttctgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.33

Weight (kDa)

9.39

Isoelectric Point (pI)

30.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012012)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 144
AccII CGCG 1 cut(s) 53
AciI CCGC 2 cut(s) 53, 94
AcoI YGGCCR 1 cut(s) 54
AcsI RAATTY 1 cut(s) 164
Alw21I GWGCWC 1 cut(s) 75
Ama87I CYCGRG 1 cut(s) 68
AoxI GGCC 1 cut(s) 54
ApoI RAATTY 1 cut(s) 164
Asp700I GAANNNNTTC 1 cut(s) 32
AspLEI GCGC 1 cut(s) 53
AvaI CYCGRG 1 cut(s) 68
Bbv12I GWGCWC 1 cut(s) 75
BccI CCATC 1 cut(s) 113
BfaI CTAG 1 cut(s) 140
BisI GCNGC 2 cut(s) 54, 94
BlsI GCNGC 2 cut(s) 55, 95
BmeT110I CYCGRG 1 cut(s) 68
BmsI GCATC 2 cut(s) 162, 175
BplI GAGNNNNNCTC 2 cut(s) 51, 83
BsaWI WCCGGW 1 cut(s) 81
Bse3DI GCAATG 1 cut(s) 123
BseGI GGATG 1 cut(s) 190
BseMI GCAATG 1 cut(s) 123
BseRI GAGGAG 2 cut(s) 21, 56
Bsh1236I CGCG 1 cut(s) 53
BshFI GGCC 1 cut(s) 56
BsiHKAI GWGCWC 1 cut(s) 75
BsiHKCI CYCGRG 1 cut(s) 68
BsiSI CCGG 1 cut(s) 82
BsnI GGCC 1 cut(s) 56
BsoBI CYCGRG 1 cut(s) 68
Bsp1286I GDGCHC 1 cut(s) 75
BspACI CCGC 2 cut(s) 53, 94
BspANI GGCC 1 cut(s) 56
BspFNI CGCG 1 cut(s) 53
BsrDI GCAATG 1 cut(s) 123
BstC8I GCNNGC 1 cut(s) 190
BstF5I GGATG 1 cut(s) 190
BstFNI CGCG 1 cut(s) 53
BstHHI GCGC 1 cut(s) 53
BstUI CGCG 1 cut(s) 53
BsuRI GGCC 1 cut(s) 56
BtsCI GGATG 1 cut(s) 190
Cac8I GCNNGC 1 cut(s) 190
CfoI GCGC 1 cut(s) 53
CviJI RGCY 1 cut(s) 56
CviKI_1 RGCY 1 cut(s) 56
EaeI YGGCCR 1 cut(s) 54
Eco88I CYCGRG 1 cut(s) 68
EcoRI GAATTC 1 cut(s) 164
FaiI YATR 3 cut(s) 171, 173, 199
FauNDI CATATG 1 cut(s) 171
FblI GTMKAC 1 cut(s) 144
Fnu4HI GCNGC 2 cut(s) 54, 94
FokI GGATG 1 cut(s) 197
Fsp4HI GCNGC 2 cut(s) 54, 94
FspBI CTAG 1 cut(s) 140
GlaI GCGC 1 cut(s) 52
GluI GCNGC 2 cut(s) 54, 94
HaeIII GGCC 1 cut(s) 56
HapII CCGG 1 cut(s) 82
HhaI GCGC 1 cut(s) 53
Hin6I GCGC 1 cut(s) 51
HinP1I GCGC 1 cut(s) 51
HinfI GANTC 2 cut(s) 88, 114
HpaII CCGG 1 cut(s) 82
Hpy166II GTNNAC 2 cut(s) 87, 145
Hpy188I TCNGA 2 cut(s) 113, 161
Hpy188III TCNNGA 1 cut(s) 68
Hpy8I GTNNAC 2 cut(s) 87, 145
HpyCH4V TGCA 2 cut(s) 175, 188
HspAI GCGC 1 cut(s) 51
LpnPI CCDG 5 cut(s) 16, 70, 95, 174, 187
LweI GCATC 2 cut(s) 162, 175
MaeI CTAG 1 cut(s) 140
MboII GAAGA 1 cut(s) 109
MhlI GDGCHC 1 cut(s) 75
MluCI AATT 1 cut(s) 164
MlyI GAGTC 1 cut(s) 82
MnlI CCTC 3 cut(s) 10, 34, 175
MroXI GAANNNNTTC 1 cut(s) 32
MspI CCGG 1 cut(s) 82
MvnI CGCG 1 cut(s) 53
NdeI CATATG 1 cut(s) 171
PaeR7I CTCGAG 1 cut(s) 68
PdmI GAANNNNTTC 1 cut(s) 32
PfeI GAWTC 1 cut(s) 114
PkrI GCNGC 2 cut(s) 55, 95
PleI GAGTC 1 cut(s) 82
PpsI GAGTC 1 cut(s) 82
SatI GCNGC 2 cut(s) 54, 94
SchI GAGTC 1 cut(s) 82
SduI GDGCHC 1 cut(s) 75
SetI ASST 1 cut(s) 35
SfaNI GCATC 2 cut(s) 162, 175
Sfr274I CTCGAG 1 cut(s) 68
SlaI CTCGAG 1 cut(s) 68
SmlI CTYRAG 1 cut(s) 68
SmoI CTYRAG 1 cut(s) 68
Sse9I AATT 1 cut(s) 164
SsiI CCGC 2 cut(s) 53, 94
SspMI CTAG 1 cut(s) 140
TaqI TCGA 1 cut(s) 69
TasI AATT 1 cut(s) 164
TauI GCSGC 2 cut(s) 56, 96
TfiI GAWTC 1 cut(s) 114
XapI RAATTY 1 cut(s) 164
XhoI CTCGAG 1 cut(s) 68
XmiI GTMKAC 1 cut(s) 144
XmnI GAANNNNTTC 1 cut(s) 32
XspI CTAG 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.