FvH4_4g06270

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
Physical Location & Seq
Forward (+)
5591790 .. 5594339
2550 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g06270.t1

Sequence Viewer

Length: 216 bp
ATGGGGGGAGGAATGGAGGCAAACAAGAACAGGTTCGTGGAGGAGTGGGGCGCCGCCAGAGAAAATCTGGAGCACAACTTCCGTTGGACTCGCCGCAATTTCGCCATCATCGGTATCTTCGGCATCGCTATCCCCGTCCTAGTCTACAAGGGCATCGTCCGCGAATTCCATATGCAAGATGAGGATGCAGGCAGACCATATAGGAAGTTTCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.33

Weight (kDa)

9.39

Isoelectric Point (pI)

30.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012012)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 50
AccI GTMKAC 1 cut(s) 144
AccII CGCG 1 cut(s) 162
AciI CCGC 3 cut(s) 54, 94, 160
AcsI RAATTY 1 cut(s) 164
AcyI GRCGYC 1 cut(s) 51
Alw21I GWGCWC 1 cut(s) 75
ApoI RAATTY 1 cut(s) 164
Asp700I GAANNNNTTC 1 cut(s) 32
AspLEI GCGC 1 cut(s) 53
BanI GGYRCC 1 cut(s) 50
Bbv12I GWGCWC 1 cut(s) 75
BccI CCATC 1 cut(s) 113
BfaI CTAG 1 cut(s) 140
BfoI RGCGCY 1 cut(s) 54
BisI GCNGC 2 cut(s) 54, 94
BlsI GCNGC 2 cut(s) 55, 95
BmiI GGNNCC 1 cut(s) 52
BmsI GCATC 3 cut(s) 132, 162, 175
BpmI CTGGAG 1 cut(s) 89
BsaHI GRCGYC 1 cut(s) 51
BseGI GGATG 1 cut(s) 190
BseRI GAGGAG 1 cut(s) 56
Bsh1236I CGCG 1 cut(s) 162
BshNI GGYRCC 1 cut(s) 50
BsiHKAI GWGCWC 1 cut(s) 75
Bsp1286I GDGCHC 1 cut(s) 75
BspACI CCGC 3 cut(s) 54, 94, 160
BspFNI CGCG 1 cut(s) 162
BspLI GGNNCC 1 cut(s) 52
BspT107I GGYRCC 1 cut(s) 50
BssNI GRCGYC 1 cut(s) 51
BstACI GRCGYC 1 cut(s) 51
BstC8I GCNNGC 1 cut(s) 190
BstF5I GGATG 1 cut(s) 190
BstFNI CGCG 1 cut(s) 162
BstH2I RGCGCY 1 cut(s) 54
BstHHI GCGC 1 cut(s) 53
BstMWI GCNNNNNNNGC 1 cut(s) 159
BstUI CGCG 1 cut(s) 162
BtgZI GCGATG 1 cut(s) 109
BtsCI GGATG 1 cut(s) 190
Cac8I GCNNGC 1 cut(s) 190
CfoI GCGC 1 cut(s) 53
DinI GGCGCC 1 cut(s) 52
EcoRI GAATTC 1 cut(s) 164
EgeI GGCGCC 1 cut(s) 52
EheI GGCGCC 1 cut(s) 52
FaiI YATR 4 cut(s) 171, 173, 199, 201
FauNDI CATATG 1 cut(s) 171
FblI GTMKAC 1 cut(s) 144
Fnu4HI GCNGC 2 cut(s) 54, 94
FokI GGATG 1 cut(s) 197
Fsp4HI GCNGC 2 cut(s) 54, 94
FspBI CTAG 1 cut(s) 140
GlaI GCGC 1 cut(s) 52
GluI GCNGC 2 cut(s) 54, 94
GsuI CTGGAG 1 cut(s) 89
HaeII RGCGCY 1 cut(s) 54
HhaI GCGC 1 cut(s) 53
Hin1I GRCGYC 1 cut(s) 51
Hin6I GCGC 1 cut(s) 51
HinP1I GCGC 1 cut(s) 51
HinfI GANTC 1 cut(s) 88
Hpy166II GTNNAC 1 cut(s) 145
Hpy188III TCNNGA 1 cut(s) 68
Hpy8I GTNNAC 1 cut(s) 145
HpyCH4V TGCA 2 cut(s) 175, 188
HpyF10VI GCNNNNNNNGC 1 cut(s) 159
Hsp92I GRCGYC 1 cut(s) 51
HspAI GCGC 1 cut(s) 51
KasI GGCGCC 1 cut(s) 50
LmnI GCTCC 1 cut(s) 70
LpnPI CCDG 4 cut(s) 16, 53, 70, 174
LweI GCATC 3 cut(s) 132, 162, 175
MaeI CTAG 1 cut(s) 140
MboII GAAGA 1 cut(s) 109
MhlI GDGCHC 1 cut(s) 75
MluCI AATT 2 cut(s) 97, 164
Mly113I GGCGCC 1 cut(s) 51
MlyI GAGTC 1 cut(s) 82
MmeI TCCRAC 1 cut(s) 65
MnlI CCTC 3 cut(s) 10, 34, 175
MroXI GAANNNNTTC 1 cut(s) 32
MvnI CGCG 1 cut(s) 162
MwoI GCNNNNNNNGC 1 cut(s) 159
NarI GGCGCC 1 cut(s) 51
NdeI CATATG 1 cut(s) 171
NlaIV GGNNCC 1 cut(s) 52
PcsI WCGNNNNNNNCGW 1 cut(s) 132
PdmI GAANNNNTTC 1 cut(s) 32
PkrI GCNGC 2 cut(s) 55, 95
PleI GAGTC 1 cut(s) 82
PluTI GGCGCC 1 cut(s) 54
PpsI GAGTC 1 cut(s) 82
PspN4I GGNNCC 1 cut(s) 52
SatI GCNGC 2 cut(s) 54, 94
SchI GAGTC 1 cut(s) 82
SduI GDGCHC 1 cut(s) 75
SetI ASST 1 cut(s) 35
SfaNI GCATC 3 cut(s) 132, 162, 175
SfoI GGCGCC 1 cut(s) 52
Sse9I AATT 2 cut(s) 97, 164
SsiI CCGC 3 cut(s) 54, 94, 160
SspDI GGCGCC 1 cut(s) 50
SspMI CTAG 1 cut(s) 140
TasI AATT 2 cut(s) 97, 164
TauI GCSGC 2 cut(s) 56, 96
TspGWI ACGGA 1 cut(s) 71
XapI RAATTY 1 cut(s) 164
XcmI CCANNNNNNNNNTGG 1 cut(s) 64
XmiI GTMKAC 1 cut(s) 144
XmnI GAANNNNTTC 1 cut(s) 32
XspI CTAG 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.