AT3G05935

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Reverse (-)
1770911 .. 1773461
2551 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G05935.1

Sequence Viewer

Length: 288 bp
ATGAACAATGAACAGAACGAGAGAGATCCTGATAACATCAACAACAAGAAGAAGAAAAAGGAATCTCCATTGTTGATTTACTCCGTCTCGAAAGCAAAGAAACGAATCGTGTCTAAGTTCAGAAGGAGACCCTTATCGCCGAATACGTCTCCTTCTTCTGGGTTTTGGAAAAGAGTCTGCTTTTGTGGAATTGAACCTGACCCTGAAGATGACAACTTTAAGCTTAGGGTTCTGCTACAGACCAATGATTTCTTCTCCAAGGATTCTAATCCACATCTCTGTTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

95

Amino Acids

11.1

Weight (kDa)

9.58

Isoelectric Point (pI)

68.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 20
AcuI CTGAAG 1 cut(s) 225
AfiI CCNNNNNNNGG 1 cut(s) 158
AgsI TTSAA 1 cut(s) 194
AjuI GAANNNNNNNTTGG 2 cut(s) 236, 268
AluBI AGCT 1 cut(s) 223
AluI AGCT 1 cut(s) 223
Alw26I GTCTC 3 cut(s) 91, 121, 153
AlwI GGATC 1 cut(s) 20
BcoDI GTCTC 3 cut(s) 91, 121, 153
BfmI CTRYAG 1 cut(s) 236
Bpu10I CCTNAGC 1 cut(s) 224
BsaBI GATNNNNATC 1 cut(s) 267
BsaI GGTCTC 1 cut(s) 121
BsaJI CCNNGG 1 cut(s) 258
Bsc4I CCNNNNNNNGG 1 cut(s) 158
Bse8I GATNNNNATC 1 cut(s) 267
BseDI CCNNGG 1 cut(s) 258
BseJI GATNNNNATC 1 cut(s) 267
BseLI CCNNNNNNNGG 1 cut(s) 158
BslI CCNNNNNNNGG 1 cut(s) 158
BsmAI GTCTC 3 cut(s) 91, 121, 153
BsmBI CGTCTC 2 cut(s) 91, 153
Bso31I GGTCTC 1 cut(s) 121
Bsp143I GATC 1 cut(s) 25
BspPI GGATC 1 cut(s) 20
BspTNI GGTCTC 1 cut(s) 121
BssECI CCNNGG 1 cut(s) 258
BssMI GATC 1 cut(s) 25
BssT1I CCWWGG 1 cut(s) 258
BstDEI CTNAG 2 cut(s) 114, 224
BstKTI GATC 1 cut(s) 28
BstMAI GTCTC 3 cut(s) 91, 121, 153
BstMBI GATC 1 cut(s) 25
BstSFI CTRYAG 1 cut(s) 236
BstX2I RGATCY 1 cut(s) 25
BstYI RGATCY 1 cut(s) 25
CviJI RGCY 1 cut(s) 223
CviKI_1 RGCY 1 cut(s) 223
DdeI CTNAG 2 cut(s) 114, 224
DpnI GATC 1 cut(s) 27
DpnII GATC 1 cut(s) 25
Eco130I CCWWGG 1 cut(s) 258
Eco31I GGTCTC 1 cut(s) 121
Eco57I CTGAAG 1 cut(s) 225
EcoT14I CCWWGG 1 cut(s) 258
ErhI CCWWGG 1 cut(s) 258
Esp3I CGTCTC 2 cut(s) 91, 153
HindIII AAGCTT 1 cut(s) 221
HinfI GANTC 4 cut(s) 62, 105, 174, 263
Hpy188I TCNGA 1 cut(s) 122
Hpy188III TCNNGA 2 cut(s) 29, 88
HpyAV CCTTC 2 cut(s) 117, 162
HpyCH4IV ACGT 1 cut(s) 146
HpyF3I CTNAG 2 cut(s) 114, 224
HpySE526I ACGT 1 cut(s) 146
Kzo9I GATC 1 cut(s) 25
LpnPI CCDG 4 cut(s) 42, 144, 210, 216
MaeII ACGT 1 cut(s) 146
MalI GATC 1 cut(s) 27
MboI GATC 1 cut(s) 25
MboII GAAGA 5 cut(s) 61, 64, 147, 218, 244
MflI RGATCY 1 cut(s) 25
MluCI AATT 1 cut(s) 189
MlyI GAGTC 1 cut(s) 183
MseI TTAA 1 cut(s) 219
NdeII GATC 1 cut(s) 25
PcsI WCGNNNNNNNCGW 1 cut(s) 143
PfeI GAWTC 3 cut(s) 62, 105, 263
PleI GAGTC 1 cut(s) 182
PpsI GAGTC 1 cut(s) 182
PsuI RGATCY 1 cut(s) 25
SaqAI TTAA 1 cut(s) 219
Sau3AI GATC 1 cut(s) 25
SchI GAGTC 1 cut(s) 183
SetI ASST 3 cut(s) 149, 199, 225
SfcI CTRYAG 1 cut(s) 236
SgeI CNNG 9 cut(s) 31, 41, 58, 100, 121, 171, 209, 215, 271
Sse9I AATT 1 cut(s) 189
StyI CCWWGG 1 cut(s) 258
TaiI ACGT 1 cut(s) 149
TaqI TCGA 1 cut(s) 89
TasI AATT 1 cut(s) 189
TfiI GAWTC 3 cut(s) 62, 105, 263
Tru1I TTAA 1 cut(s) 219
Tru9I TTAA 1 cut(s) 219
TspDTI ATGAA 2 cut(s) 17, 24
TspGWI ACGGA 1 cut(s) 73
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.