Rh3BG093800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Reverse (-)
7460519 .. 7463980
3462 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG093800.1

Sequence Viewer

Length: 486 bp
ATGTCTGTGCTTGATAAAGAGATATCAAGCAGTGGTAGAGATTGTGGGGACGATGATGGTAATGAGGACGAGGATGAAAATGGTGGTGGGGTCAATGGCAGATGTAGATGCAGAGCCAAGGATGCAAAGAAGCAGAGTAGTGGAATTAGGTTTTCAAGAAATTTGGGAAAGGCCAAACAGGTGGTCCTGTCTCCATTCACAAAAGCCAAGAAGCAATTACCCAGAAGAAACAGGACTGCTGGTTCTTCTTCTTCTTGTTCACCGTTTTCTTCAGGTAAGAGGCTTGGAGTTAGTGGAGGTAATCAAGGCTGTTACTTATGTTTCATGCAACCATTAACTGTGGATTCATCTGCTGAGTCTCCGTCCAGCGATCCGAATAGCCCGAATTTTACTTATGGGAAGTTGAGGAGTTTAATTGAAAAGAATGATTTCTATTCTAGAGAGTGCAATTACCATTTGGATTTTGATCCTAAATCGCCATGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

161

Amino Acids

17.51

Weight (kDa)

8.79

Isoelectric Point (pI)

71.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 365, 461
AcsI RAATTY 2 cut(s) 160, 385
AcuI CTGAAG 1 cut(s) 255
AgsI TTSAA 2 cut(s) 156, 419
AloI GAACNNNNNNTCC 2 cut(s) 226, 258
Alw26I GTCTC 2 cut(s) 195, 363
AlwI GGATC 2 cut(s) 365, 461
AoxI GGCC 1 cut(s) 171
ApoI RAATTY 2 cut(s) 160, 385
ArsI GACNNNNNNTTYG 2 cut(s) 168, 200
Asp700I GAANNNNTTC 1 cut(s) 428
AspS9I GGNCC 1 cut(s) 184
AsuHPI GGTGA 1 cut(s) 252
AvaII GGWCC 1 cut(s) 184
BccI CCATC 1 cut(s) 50
BcoDI GTCTC 2 cut(s) 195, 363
BfaI CTAG 2 cut(s) 438, 484
Bme18I GGWCC 1 cut(s) 184
BmgT120I GGNCC 1 cut(s) 184
BmsI GCATC 2 cut(s) 98, 112
BsaBI GATNNNNATC 1 cut(s) 465
BsaJI CCNNGG 1 cut(s) 117
Bse8I GATNNNNATC 1 cut(s) 465
BseDI CCNNGG 1 cut(s) 117
BseGI GGATG 2 cut(s) 79, 127
BseJI GATNNNNATC 1 cut(s) 465
BseMII CTCAG 1 cut(s) 345
BseRI GAGGAG 1 cut(s) 421
BshFI GGCC 1 cut(s) 173
BslFI GGGAC 1 cut(s) 62
BsmAI GTCTC 2 cut(s) 195, 363
BsmFI GGGAC 1 cut(s) 62
BsnI GGCC 1 cut(s) 173
Bsp143I GATC 2 cut(s) 370, 466
BspANI GGCC 1 cut(s) 173
BspCNI CTCAG 1 cut(s) 346
BspPI GGATC 2 cut(s) 365, 461
BssECI CCNNGG 1 cut(s) 117
BssMI GATC 2 cut(s) 370, 466
BssT1I CCWWGG 1 cut(s) 117
Bst4CI ACNGT 2 cut(s) 264, 340
BstDEI CTNAG 1 cut(s) 354
BstF5I GGATG 2 cut(s) 79, 127
BstKTI GATC 2 cut(s) 373, 469
BstMAI GTCTC 2 cut(s) 195, 363
BstMBI GATC 2 cut(s) 370, 466
BstMWI GCNNNNNNNGC 1 cut(s) 122
BstXI CCANNNNNNTGG 1 cut(s) 181
BsuRI GGCC 1 cut(s) 173
BtsCI GGATG 2 cut(s) 79, 127
BtsI GCAGTG 1 cut(s) 37
BtsIMutI CAGTG 1 cut(s) 37
Cfr13I GGNCC 1 cut(s) 184
CviAII CATG 2 cut(s) 325, 480
CviJI RGCY 6 cut(s) 116, 173, 206, 283, 309, 381
CviKI_1 RGCY 6 cut(s) 116, 173, 206, 283, 309, 381
DdeI CTNAG 1 cut(s) 354
DpnI GATC 2 cut(s) 372, 468
DpnII GATC 2 cut(s) 370, 466
Eco130I CCWWGG 1 cut(s) 117
Eco32I GATATC 1 cut(s) 24
Eco47I GGWCC 1 cut(s) 184
Eco57I CTGAAG 1 cut(s) 255
EcoRV GATATC 1 cut(s) 24
EcoT14I CCWWGG 1 cut(s) 117
ErhI CCWWGG 1 cut(s) 117
FaeI CATG 2 cut(s) 328, 483
FaiI YATR 4 cut(s) 319, 326, 396, 481
FaqI GGGAC 1 cut(s) 62
FatI CATG 2 cut(s) 324, 479
FokI GGATG 2 cut(s) 86, 134
FspBI CTAG 2 cut(s) 438, 484
HaeIII GGCC 1 cut(s) 173
Hin1II CATG 2 cut(s) 328, 483
HinfI GANTC 2 cut(s) 344, 356
HphI GGTGA 1 cut(s) 252
Hpy166II GTNNAC 1 cut(s) 260
Hpy188I TCNGA 1 cut(s) 375
Hpy188III TCNNGA 2 cut(s) 156, 438
Hpy8I GTNNAC 1 cut(s) 260
HpyCH4III ACNGT 2 cut(s) 264, 340
HpyCH4V TGCA 4 cut(s) 111, 125, 328, 447
HpyF10VI GCNNNNNNNGC 1 cut(s) 122
HpyF3I CTNAG 1 cut(s) 354
Hsp92II CATG 2 cut(s) 328, 483
Kzo9I GATC 2 cut(s) 370, 466
LpnPI CCDG 7 cut(s) 164, 200, 217, 225, 235, 258, 379
LweI GCATC 2 cut(s) 98, 112
MaeI CTAG 2 cut(s) 438, 484
MaeIII GTNAC 1 cut(s) 311
MalI GATC 2 cut(s) 372, 468
MboI GATC 2 cut(s) 370, 466
MboII GAAGA 5 cut(s) 237, 237, 240, 243, 261
MluCI AATT 6 cut(s) 144, 160, 215, 385, 414, 448
MlyI GAGTC 1 cut(s) 365
MnlI CCTC 5 cut(s) 58, 64, 273, 290, 399
MroXI GAANNNNTTC 1 cut(s) 428
MseI TTAA 2 cut(s) 335, 413
MwoI GCNNNNNNNGC 1 cut(s) 122
NdeII GATC 2 cut(s) 370, 466
NlaIII CATG 2 cut(s) 328, 483
PdmI GAANNNNTTC 1 cut(s) 428
PfeI GAWTC 1 cut(s) 344
PleI GAGTC 1 cut(s) 364
PpsI GAGTC 1 cut(s) 364
PspPI GGNCC 1 cut(s) 184
SaqAI TTAA 2 cut(s) 335, 413
Sau3AI GATC 2 cut(s) 370, 466
Sau96I GGNCC 1 cut(s) 184
SchI GAGTC 1 cut(s) 365
SetI ASST 4 cut(s) 152, 183, 277, 301
SfaNI GCATC 2 cut(s) 98, 112
SinI GGWCC 1 cut(s) 184
Sse9I AATT 6 cut(s) 144, 160, 215, 385, 414, 448
SspMI CTAG 2 cut(s) 438, 484
StyI CCWWGG 1 cut(s) 117
TaaI ACNGT 2 cut(s) 264, 340
TasI AATT 6 cut(s) 144, 160, 215, 385, 414, 448
TfiI GAWTC 1 cut(s) 344
Tru1I TTAA 2 cut(s) 335, 413
Tru9I TTAA 2 cut(s) 335, 413
TscAI CASTG 1 cut(s) 37
TspDTI ATGAA 3 cut(s) 90, 313, 336
TspGWI ACGGA 1 cut(s) 351
TspRI CASTG 1 cut(s) 37
VpaK11BI GGWCC 1 cut(s) 184
XapI RAATTY 2 cut(s) 160, 385
XbaI TCTAGA 1 cut(s) 437
XmnI GAANNNNTTC 1 cut(s) 428
XspI CTAG 2 cut(s) 438, 484
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.