AT3G15395

endonuclease activity

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Forward (+)
5200639 .. 5201514
876 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G15395.3

Sequence Viewer

Length: 180 bp
ATGGGATCGAGAGGGATTATCAACGATAAGTGGTCAATGAGGATTCTATGGGGTTGTGCTATCGGAAGTGCTATTGGTTTATACATGGTTGCTGTAGAGAGACAAACTCAGAACAGGGCTCGTGCTATGGCTGAGAGTTTGAGAGCTGCTGAATCACAAGGTGATGGTGATAATGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.41

Weight (kDa)

7.96

Isoelectric Point (pI)

37.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 13
AdeI CACNNNGTG 1 cut(s) 161
AluBI AGCT 1 cut(s) 146
AluI AGCT 1 cut(s) 146
Alw26I GTCTC 1 cut(s) 94
AlwI GGATC 1 cut(s) 13
ApeKI GCWGC 1 cut(s) 146
AsuHPI GGTGA 2 cut(s) 173, 179
BanII GRGCYC 1 cut(s) 121
BauI CACGAG 1 cut(s) 120
BbvI GCAGC 1 cut(s) 133
BccI CCATC 1 cut(s) 158
BcoDI GTCTC 1 cut(s) 94
BfmI CTRYAG 1 cut(s) 93
BisI GCNGC 1 cut(s) 147
BlsI GCNGC 1 cut(s) 148
BplI GAGNNNNNCTC 2 cut(s) 91, 123
BseMII CTCAG 2 cut(s) 122, 123
BseXI GCAGC 1 cut(s) 133
BsmAI GTCTC 1 cut(s) 94
Bsp1286I GDGCHC 1 cut(s) 121
Bsp143I GATC 1 cut(s) 5
BspCNI CTCAG 2 cut(s) 121, 124
BspPI GGATC 1 cut(s) 13
BssMI GATC 1 cut(s) 5
BssSI CACGAG 1 cut(s) 120
Bst2BI CACGAG 1 cut(s) 120
BstDEI CTNAG 2 cut(s) 108, 132
BstKTI GATC 1 cut(s) 8
BstMAI GTCTC 1 cut(s) 94
BstMBI GATC 1 cut(s) 5
BstSFI CTRYAG 1 cut(s) 93
BstV1I GCAGC 1 cut(s) 133
CviAII CATG 1 cut(s) 85
CviJI RGCY 3 cut(s) 119, 131, 146
CviKI_1 RGCY 3 cut(s) 119, 131, 146
DdeI CTNAG 2 cut(s) 108, 132
DpnI GATC 1 cut(s) 7
DpnII GATC 1 cut(s) 5
DraIII CACNNNGTG 1 cut(s) 161
Eco24I GRGCYC 1 cut(s) 121
EcoT38I GRGCYC 1 cut(s) 121
FaeI CATG 1 cut(s) 88
FaiI YATR 4 cut(s) 49, 82, 86, 128
FatI CATG 1 cut(s) 84
Fnu4HI GCNGC 1 cut(s) 147
FriOI GRGCYC 1 cut(s) 121
Fsp4HI GCNGC 1 cut(s) 147
GluI GCNGC 1 cut(s) 147
Hin1II CATG 1 cut(s) 88
HinfI GANTC 2 cut(s) 43, 152
HphI GGTGA 2 cut(s) 173, 179
Hpy188I TCNGA 2 cut(s) 65, 111
Hpy188III TCNNGA 1 cut(s) 9
HpyF3I CTNAG 2 cut(s) 108, 132
Hsp92II CATG 1 cut(s) 88
Kzo9I GATC 1 cut(s) 5
LpnPI CCDG 1 cut(s) 100
Lsp1109I GCAGC 1 cut(s) 133
MalI GATC 1 cut(s) 7
MboI GATC 1 cut(s) 5
MhlI GDGCHC 1 cut(s) 121
MnlI CCTC 2 cut(s) 5, 33
NdeII GATC 1 cut(s) 5
NlaIII CATG 1 cut(s) 88
PfeI GAWTC 2 cut(s) 43, 152
PkrI GCNGC 1 cut(s) 148
SatI GCNGC 1 cut(s) 147
Sau3AI GATC 1 cut(s) 5
SduI GDGCHC 1 cut(s) 121
SetI ASST 2 cut(s) 148, 163
SfcI CTRYAG 1 cut(s) 93
SgeI CNNG 6 cut(s) 21, 97, 127, 132, 134, 170
TaqI TCGA 1 cut(s) 8
TfiI GAWTC 2 cut(s) 43, 152
TseI GCWGC 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.