Rw5G021670

endonuclease activity

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Forward (+)
29417933 .. 29418576
644 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G021670.1

Sequence Viewer

Length: 183 bp
ATGGGAGCCAGAGGAGTTATTACTGATAAATGGTCCATGAGGGTTCTCTGGGCCTGTGCAATTGGAAGTGCTATAAGCCTGTATTTTGTTGCTGCGGAAAGGCAAGCACAGAACAGGGAACGGATGTTAGCTGAAAGTTTAAAGGCCATGGAGGAAGAATCACGCAATGCTGCAGATGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.66

Weight (kDa)

6.17

Isoelectric Point (pI)

36.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 95
AluBI AGCT 1 cut(s) 131
AluI AGCT 1 cut(s) 131
AoxI GGCC 2 cut(s) 51, 144
ApeKI GCWGC 2 cut(s) 92, 170
AspS9I GGNCC 2 cut(s) 33, 51
AvaII GGWCC 1 cut(s) 33
BbvI GCAGC 2 cut(s) 79, 157
BfmI CTRYAG 1 cut(s) 171
BisI GCNGC 2 cut(s) 93, 171
BlsI GCNGC 2 cut(s) 94, 172
Bme18I GGWCC 1 cut(s) 33
BmgT120I GGNCC 2 cut(s) 33, 51
BmiI GGNNCC 1 cut(s) 7
BmsI GCATC 1 cut(s) 166
BsaJI CCNNGG 1 cut(s) 147
Bse3DI GCAATG 1 cut(s) 172
BseDI CCNNGG 1 cut(s) 147
BseGI GGATG 1 cut(s) 129
BseMI GCAATG 1 cut(s) 172
BseRI GAGGAG 1 cut(s) 27
BseXI GCAGC 2 cut(s) 79, 157
BshFI GGCC 2 cut(s) 53, 146
BsnI GGCC 2 cut(s) 53, 146
Bsp19I CCATGG 1 cut(s) 147
BspACI CCGC 1 cut(s) 95
BspANI GGCC 2 cut(s) 53, 146
BspLI GGNNCC 1 cut(s) 7
BspMAI CTGCAG 1 cut(s) 175
BsrDI GCAATG 1 cut(s) 172
BssECI CCNNGG 1 cut(s) 147
BssT1I CCWWGG 1 cut(s) 147
BstC8I GCNNGC 1 cut(s) 105
BstDSI CCRYGG 1 cut(s) 147
BstF5I GGATG 1 cut(s) 129
BstMWI GCNNNNNNNGC 1 cut(s) 176
BstSFI CTRYAG 1 cut(s) 171
BstV1I GCAGC 2 cut(s) 79, 157
BsuRI GGCC 2 cut(s) 53, 146
BtgI CCRYGG 1 cut(s) 147
BtsCI GGATG 1 cut(s) 129
Cac8I GCNNGC 1 cut(s) 105
Cfr13I GGNCC 2 cut(s) 33, 51
CviAII CATG 2 cut(s) 37, 148
CviJI RGCY 5 cut(s) 8, 53, 78, 131, 146
CviKI_1 RGCY 5 cut(s) 8, 53, 78, 131, 146
DraI TTTAAA 1 cut(s) 141
Eco130I CCWWGG 1 cut(s) 147
Eco47I GGWCC 1 cut(s) 33
EcoT14I CCWWGG 1 cut(s) 147
ErhI CCWWGG 1 cut(s) 147
FaeI CATG 2 cut(s) 40, 151
FaiI YATR 3 cut(s) 38, 74, 149
FatI CATG 2 cut(s) 36, 147
Fnu4HI GCNGC 2 cut(s) 93, 171
FokI GGATG 1 cut(s) 136
Fsp4HI GCNGC 2 cut(s) 93, 171
GluI GCNGC 2 cut(s) 93, 171
HaeIII GGCC 2 cut(s) 53, 146
Hin1II CATG 2 cut(s) 40, 151
HinfI GANTC 1 cut(s) 158
HpyCH4V TGCA 2 cut(s) 59, 173
HpyF10VI GCNNNNNNNGC 1 cut(s) 176
Hsp92II CATG 2 cut(s) 40, 151
LmnI GCTCC 1 cut(s) 5
LpnPI CCDG 5 cut(s) 22, 34, 67, 92, 100
Lsp1109I GCAGC 2 cut(s) 79, 157
LweI GCATC 1 cut(s) 166
MboII GAAGA 1 cut(s) 167
MfeI CAATTG 1 cut(s) 60
MluCI AATT 1 cut(s) 60
MnlI CCTC 3 cut(s) 5, 33, 145
MseI TTAA 1 cut(s) 140
MunI CAATTG 1 cut(s) 60
MwoI GCNNNNNNNGC 1 cut(s) 176
NcoI CCATGG 1 cut(s) 147
NlaIII CATG 2 cut(s) 40, 151
NlaIV GGNNCC 1 cut(s) 7
PfeI GAWTC 1 cut(s) 158
PkrI GCNGC 2 cut(s) 94, 172
PspN4I GGNNCC 1 cut(s) 7
PspPI GGNCC 2 cut(s) 33, 51
PstI CTGCAG 1 cut(s) 175
SaqAI TTAA 1 cut(s) 140
SatI GCNGC 2 cut(s) 93, 171
Sau96I GGNCC 2 cut(s) 33, 51
SetI ASST 1 cut(s) 133
SfaNI GCATC 1 cut(s) 166
SfcI CTRYAG 1 cut(s) 171
SgeI CNNG 9 cut(s) 21, 49, 61, 66, 91, 116, 127, 160, 174
SinI GGWCC 1 cut(s) 33
Sse9I AATT 1 cut(s) 60
SsiI CCGC 1 cut(s) 95
StyI CCWWGG 1 cut(s) 147
TasI AATT 1 cut(s) 60
TfiI GAWTC 1 cut(s) 158
Tru1I TTAA 1 cut(s) 140
Tru9I TTAA 1 cut(s) 140
TseI GCWGC 2 cut(s) 92, 170
TspGWI ACGGA 1 cut(s) 136
VpaK11BI GGWCC 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.