Prupe.4G184300_v2.0.a1

endonuclease activity

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
10926227 .. 10928407
2181 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G184300.1

Sequence Viewer

Length: 246 bp
ATGAGGTTTAGTATCCAATATGTTGTCATACTAAAGCAGTCTAATTGGGTTTGGCAGCAAGGTATGGGAGCCAGAGGAGTTATTGGGGATAGATGGTCCATGAGGATTCTATGGGCCTGTGCAATTGGAAGTGCTGCCAGCCTATACATGGTTGCTGCGGAAAGGCAAGCACAGAACAGGCAACGAATGTTGGCTGAAGAGTTAAAGGCCATGGAGGCAGAATCAGGCAATGGCGAGGTCGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.13

Weight (kDa)

9.1

Isoelectric Point (pI)

41.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 158
AcuI CTGAAG 1 cut(s) 216
AfiI CCNNNNNNNGG 1 cut(s) 148
AoxI GGCC 2 cut(s) 114, 207
ApeKI GCWGC 3 cut(s) 55, 134, 155
AspS9I GGNCC 2 cut(s) 96, 114
AvaII GGWCC 1 cut(s) 96
BbvI GCAGC 3 cut(s) 67, 121, 142
BccI CCATC 1 cut(s) 87
BciVI GTATCC 1 cut(s) 23
BfuI GTATCC 1 cut(s) 23
BglI GCCNNNNNGGC 1 cut(s) 215
BisI GCNGC 3 cut(s) 56, 135, 156
BlsI GCNGC 3 cut(s) 57, 136, 157
Bme18I GGWCC 1 cut(s) 96
BmgT120I GGNCC 2 cut(s) 96, 114
BmiI GGNNCC 1 cut(s) 70
BsaJI CCNNGG 1 cut(s) 210
Bsc4I CCNNNNNNNGG 1 cut(s) 148
Bse3DI GCAATG 1 cut(s) 235
BseDI CCNNGG 1 cut(s) 210
BseLI CCNNNNNNNGG 1 cut(s) 148
BseMI GCAATG 1 cut(s) 235
BseRI GAGGAG 1 cut(s) 90
BseXI GCAGC 3 cut(s) 67, 121, 142
BshFI GGCC 2 cut(s) 116, 209
BslI CCNNNNNNNGG 1 cut(s) 148
BsnI GGCC 2 cut(s) 116, 209
Bsp19I CCATGG 1 cut(s) 210
BspACI CCGC 1 cut(s) 158
BspANI GGCC 2 cut(s) 116, 209
BspLI GGNNCC 1 cut(s) 70
BsrDI GCAATG 1 cut(s) 235
BssECI CCNNGG 1 cut(s) 210
BssT1I CCWWGG 1 cut(s) 210
Bst6I CTCTTC 1 cut(s) 192
BstC8I GCNNGC 2 cut(s) 139, 168
BstDSI CCRYGG 1 cut(s) 210
BstMWI GCNNNNNNNGC 1 cut(s) 215
BstV1I GCAGC 3 cut(s) 67, 121, 142
BsuI GTATCC 1 cut(s) 23
BsuRI GGCC 2 cut(s) 116, 209
BtgI CCRYGG 1 cut(s) 210
Cac8I GCNNGC 2 cut(s) 139, 168
Cfr13I GGNCC 2 cut(s) 96, 114
CviAII CATG 3 cut(s) 100, 148, 211
CviJI RGCY 5 cut(s) 71, 116, 141, 194, 209
CviKI_1 RGCY 5 cut(s) 71, 116, 141, 194, 209
Eam1104I CTCTTC 1 cut(s) 192
EarI CTCTTC 1 cut(s) 192
Eco130I CCWWGG 1 cut(s) 210
Eco47I GGWCC 1 cut(s) 96
Eco57I CTGAAG 1 cut(s) 216
EcoT14I CCWWGG 1 cut(s) 210
ErhI CCWWGG 1 cut(s) 210
FaeI CATG 3 cut(s) 103, 151, 214
FaiI YATR 8 cut(s) 21, 29, 65, 101, 112, 145, 149, 212
FatI CATG 3 cut(s) 99, 147, 210
Fnu4HI GCNGC 3 cut(s) 56, 135, 156
Fsp4HI GCNGC 3 cut(s) 56, 135, 156
GluI GCNGC 3 cut(s) 56, 135, 156
HaeIII GGCC 2 cut(s) 116, 209
Hin1II CATG 3 cut(s) 103, 151, 214
HinfI GANTC 2 cut(s) 106, 221
HpyCH4V TGCA 1 cut(s) 122
HpyF10VI GCNNNNNNNGC 1 cut(s) 215
Hsp92II CATG 3 cut(s) 103, 151, 214
LmnI GCTCC 1 cut(s) 68
LpnPI CCDG 5 cut(s) 85, 130, 151, 163, 210
Lsp1109I GCAGC 3 cut(s) 67, 121, 142
MboII GAAGA 1 cut(s) 209
MfeI CAATTG 1 cut(s) 123
MluCI AATT 2 cut(s) 43, 123
MnlI CCTC 4 cut(s) 68, 96, 208, 229
MseI TTAA 1 cut(s) 203
MunI CAATTG 1 cut(s) 123
MwoI GCNNNNNNNGC 1 cut(s) 215
NcoI CCATGG 1 cut(s) 210
NlaIII CATG 3 cut(s) 103, 151, 214
NlaIV GGNNCC 1 cut(s) 70
PfeI GAWTC 2 cut(s) 106, 221
PkrI GCNGC 3 cut(s) 57, 136, 157
PspN4I GGNNCC 1 cut(s) 70
PspPI GGNCC 2 cut(s) 96, 114
SaqAI TTAA 1 cut(s) 203
SatI GCNGC 3 cut(s) 56, 135, 156
Sau96I GGNCC 2 cut(s) 96, 114
SetI ASST 3 cut(s) 8, 64, 240
SinI GGWCC 1 cut(s) 96
Sse9I AATT 2 cut(s) 43, 123
SsiI CCGC 1 cut(s) 158
StyI CCWWGG 1 cut(s) 210
TasI AATT 2 cut(s) 43, 123
TfiI GAWTC 2 cut(s) 106, 221
Tru1I TTAA 1 cut(s) 203
Tru9I TTAA 1 cut(s) 203
TseI GCWGC 3 cut(s) 55, 134, 155
VpaK11BI GGWCC 1 cut(s) 96
XcmI CCANNNNNNNNNTGG 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.