AT3G26980

May serve as docking site to facilitate the association of other proteins to the plasma membrane

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Reverse (-)
9945756 .. 9948084
2329 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G26980.1

Sequence Viewer

Length: 363 bp
ATGCCGGAGGAAGATTTGGTAGAACTGAAATTCCGGTTATATGACGGTTCAGATGTTGGCCCGTTTCAGTACTCTCCAACCGCCACAGTGTCAATGCTTAAGGAGAGAATTGTCTCTGAATGGCCTAAAGACAAGAAGATTGTTCCAAAATCAGCTAGTGACATCAAGTTGATAAATGCTGGTAAGATTTTGGAGAATGGTAAAACTGTTGCACAGTGTAAAGCTCCATTTGATGATCTCCCTAAATCCGTCATTACAATGCATGTTGTCGTGCAACTGTCTCCAACAAAAGCAAGACCAGAGAAAAAAATCGAAAAGGAAGAAGCCCCACAGAGAAGCTTTTGCTCATGTACCATAATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

120

Amino Acids

13.45

Weight (kDa)

8.41

Isoelectric Point (pI)

54.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD_2 PF13881 5 - 118 3.8e-39 Ubiquitin-2 like Rad60 SUMO-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014969)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G26980
fragaria_vesca FvH4_6g53910
malus_domestica MD09G1007300.v1.1 MD17G1011200.v1.1
prunus_persica Prupe.3G309700_v2.0.a1
pyrus_communis pycom111g00560 pycom17g00590
rosa_chinensis RchiOBHm_Chr2g0176071
rosa_laevigata RLG00000022378
rosa_roxburghii Rroxscaffold_2G00076790
rosa_rugosa Rorug02G0590200
rosa_samantha Rh2AG669000 Rh2BG680600 Rh2CG643500 Rh2DG694300
rosa_wichuraiana Rw2G054870

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 81
AcsI RAATTY 1 cut(s) 29
AfaI GTAC 2 cut(s) 71, 352
AflII CTTAAG 1 cut(s) 98
AloI GAACNNNNNNTCC 2 cut(s) 15, 47
AluBI AGCT 3 cut(s) 155, 224, 339
AluI AGCT 3 cut(s) 155, 224, 339
Alw26I GTCTC 2 cut(s) 118, 285
AoxI GGCC 2 cut(s) 58, 122
ApoI RAATTY 1 cut(s) 29
AspS9I GGNCC 1 cut(s) 59
BcoDI GTCTC 2 cut(s) 118, 285
BfaI CTAG 1 cut(s) 156
BfrI CTTAAG 1 cut(s) 98
BmcAI AGTACT 1 cut(s) 71
BmgT120I GGNCC 1 cut(s) 59
BsaWI WCCGGW 1 cut(s) 33
BshFI GGCC 2 cut(s) 60, 124
BsiSI CCGG 2 cut(s) 5, 34
BsmAI GTCTC 2 cut(s) 118, 285
BsnI GGCC 2 cut(s) 60, 124
Bsp143I GATC 1 cut(s) 235
BspACI CCGC 1 cut(s) 81
BspANI GGCC 2 cut(s) 60, 124
BspTI CTTAAG 1 cut(s) 98
BssMI GATC 1 cut(s) 235
Bst4CI ACNGT 5 cut(s) 47, 88, 208, 216, 279
BstAFI CTTAAG 1 cut(s) 98
BstKTI GATC 1 cut(s) 238
BstMAI GTCTC 2 cut(s) 118, 285
BstMBI GATC 1 cut(s) 235
BstNSI RCATGY 1 cut(s) 266
BsuRI GGCC 2 cut(s) 60, 124
BtsIMutI CAGTG 2 cut(s) 93, 221
Cfr13I GGNCC 1 cut(s) 59
Csp6I GTAC 2 cut(s) 70, 351
CviAII CATG 2 cut(s) 263, 348
CviJI RGCY 6 cut(s) 60, 124, 155, 224, 326, 339
CviKI_1 RGCY 6 cut(s) 60, 124, 155, 224, 326, 339
CviQI GTAC 2 cut(s) 70, 351
DpnI GATC 1 cut(s) 237
DpnII GATC 1 cut(s) 235
EcoT22I ATGCAT 1 cut(s) 264
FaeI CATG 2 cut(s) 266, 351
FaiI YATR 5 cut(s) 40, 42, 264, 349, 356
FatI CATG 2 cut(s) 262, 347
FspBI CTAG 1 cut(s) 156
HaeIII GGCC 2 cut(s) 60, 124
HapII CCGG 2 cut(s) 5, 34
Hin1II CATG 2 cut(s) 266, 351
HindIII AAGCTT 1 cut(s) 337
HpaII CCGG 2 cut(s) 5, 34
Hpy188I TCNGA 2 cut(s) 52, 118
HpyCH4III ACNGT 5 cut(s) 47, 88, 208, 216, 279
HpyCH4V TGCA 3 cut(s) 212, 262, 274
Hsp92II CATG 2 cut(s) 266, 351
Kzo9I GATC 1 cut(s) 235
LmnI GCTCC 1 cut(s) 229
LpnPI CCDG 4 cut(s) 18, 47, 165, 312
MaeI CTAG 1 cut(s) 156
MaeIII GTNAC 1 cut(s) 158
MalI GATC 1 cut(s) 237
MboI GATC 1 cut(s) 235
MboII GAAGA 3 cut(s) 23, 148, 332
MluCI AATT 2 cut(s) 29, 108
MmeI TCCRAC 2 cut(s) 101, 308
Mph1103I ATGCAT 1 cut(s) 264
MseI TTAA 1 cut(s) 99
MslI CAYNNNNRTG 1 cut(s) 257
MspCI CTTAAG 1 cut(s) 98
MspI CCGG 2 cut(s) 5, 34
NdeII GATC 1 cut(s) 235
NlaIII CATG 2 cut(s) 266, 351
NmuCI GTSAC 1 cut(s) 158
NsiI ATGCAT 1 cut(s) 264
NspI RCATGY 1 cut(s) 266
PspPI GGNCC 1 cut(s) 59
RsaI GTAC 2 cut(s) 71, 352
RsaNI GTAC 2 cut(s) 70, 351
RseI CAYNNNNRTG 1 cut(s) 257
SaqAI TTAA 1 cut(s) 99
Sau3AI GATC 1 cut(s) 235
Sau96I GGNCC 1 cut(s) 59
ScaI AGTACT 1 cut(s) 71
SetI ASST 3 cut(s) 157, 226, 341
SmiMI CAYNNNNRTG 1 cut(s) 257
SmlI CTYRAG 1 cut(s) 98
SmoI CTYRAG 1 cut(s) 98
Sse9I AATT 2 cut(s) 29, 108
SsiI CCGC 1 cut(s) 81
SspMI CTAG 1 cut(s) 156
TaaI ACNGT 5 cut(s) 47, 88, 208, 216, 279
TaqI TCGA 1 cut(s) 312
TasI AATT 2 cut(s) 29, 108
TatI WGTACW 1 cut(s) 69
Tru1I TTAA 1 cut(s) 99
Tru9I TTAA 1 cut(s) 99
TscAI CASTG 2 cut(s) 93, 221
TseFI GTSAC 1 cut(s) 158
Tsp45I GTSAC 1 cut(s) 158
TspGWI ACGGA 1 cut(s) 238
TspRI CASTG 2 cut(s) 93, 221
Vha464I CTTAAG 1 cut(s) 98
XapI RAATTY 1 cut(s) 29
XceI RCATGY 1 cut(s) 266
XspI CTAG 1 cut(s) 156
ZrmI AGTACT 1 cut(s) 71
Zsp2I ATGCAT 1 cut(s) 264
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.