AT3G61640

Arabinogalactan peptide

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Reverse (-)
22810041 .. 22811024
984 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G61640.1

Sequence Viewer

Length: 225 bp
ATGGCGTCGAGGAACTCCGTTGCCGTAATCGCTTTATTCGCTTTCGTTTTCGCCGTCATCTCTCCATTCGCCGGCGCTCAATCCTTAGCTCCTGCTCCTTCCCCCACTAGCGACGGAACATCGATTGATCAAGGAATCGCGTATTTGCTAATGGTGGTGGCGTTGGTGCTGACGTATCTCATTCATCCTCTTGATGCATCTTCTTCCTCCTACACCTTCTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

7.7

Weight (kDa)

4.41

Isoelectric Point (pI)

52.79

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AGP PF06376 30 - 62 1.1e-18 Arabinogalactan peptide
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017881)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 140
AcyI GRCGYC 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 71
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
AspLEI GCGC 1 cut(s) 77
BceAI ACGGC 2 cut(s) 8, 38
BclI TGATCA 1 cut(s) 127
BfaI CTAG 1 cut(s) 108
BfoI RGCGCY 1 cut(s) 78
BmsI GCATC 2 cut(s) 184, 206
Bpu10I CCTNAGC 1 cut(s) 85
Bsa29I ATCGAT 1 cut(s) 122
BsaHI GRCGYC 1 cut(s) 5
Bsc4I CCNNNNNNNGG 1 cut(s) 71
Bse118I RCCGGY 1 cut(s) 71
BseCI ATCGAT 1 cut(s) 122
BseGI GGATG 1 cut(s) 184
BseLI CCNNNNNNNGG 1 cut(s) 71
Bsh1236I CGCG 1 cut(s) 140
BshVI ATCGAT 1 cut(s) 122
BsiSI CCGG 1 cut(s) 72
BslI CCNNNNNNNGG 1 cut(s) 71
Bsp143I GATC 1 cut(s) 127
BspDI ATCGAT 1 cut(s) 122
BspFNI CGCG 1 cut(s) 140
BsrFI RCCGGY 1 cut(s) 71
BssAI RCCGGY 1 cut(s) 71
BssMI GATC 1 cut(s) 127
BssNI GRCGYC 1 cut(s) 5
BstACI GRCGYC 1 cut(s) 5
BstC8I GCNNGC 1 cut(s) 73
BstDEI CTNAG 1 cut(s) 85
BstF5I GGATG 1 cut(s) 184
BstFNI CGCG 1 cut(s) 140
BstH2I RGCGCY 1 cut(s) 78
BstHHI GCGC 1 cut(s) 77
BstKTI GATC 1 cut(s) 130
BstMBI GATC 1 cut(s) 127
BstMWI GCNNNNNNNGC 2 cut(s) 29, 38
BstUI CGCG 1 cut(s) 140
Bsu15I ATCGAT 1 cut(s) 122
BsuTUI ATCGAT 1 cut(s) 122
BtsCI GGATG 1 cut(s) 184
Cac8I GCNNGC 1 cut(s) 73
CfoI GCGC 1 cut(s) 77
Cfr10I RCCGGY 1 cut(s) 71
ClaI ATCGAT 1 cut(s) 122
CviJI RGCY 1 cut(s) 89
CviKI_1 RGCY 1 cut(s) 89
DdeI CTNAG 1 cut(s) 85
DpnI GATC 1 cut(s) 129
DpnII GATC 1 cut(s) 127
EcoT22I ATGCAT 1 cut(s) 199
FbaI TGATCA 1 cut(s) 127
FokI GGATG 1 cut(s) 171
FspBI CTAG 1 cut(s) 108
GlaI GCGC 1 cut(s) 76
HaeII RGCGCY 1 cut(s) 78
HapII CCGG 1 cut(s) 72
HhaI GCGC 1 cut(s) 77
Hin1I GRCGYC 1 cut(s) 5
Hin6I GCGC 1 cut(s) 75
HinP1I GCGC 1 cut(s) 75
HinfI GANTC 1 cut(s) 135
HpaII CCGG 1 cut(s) 72
Hpy188III TCNNGA 1 cut(s) 191
Hpy99I CGWCG 2 cut(s) 10, 116
HpyAV CCTTC 1 cut(s) 108
HpyCH4IV ACGT 1 cut(s) 173
HpyCH4V TGCA 1 cut(s) 197
HpyF10VI GCNNNNNNNGC 2 cut(s) 29, 38
HpyF3I CTNAG 1 cut(s) 85
HpySE526I ACGT 1 cut(s) 173
Hsp92I GRCGYC 1 cut(s) 5
HspAI GCGC 1 cut(s) 75
KroI GCCGGC 1 cut(s) 71
KroNI GCCGGC 1 cut(s) 73
Ksp22I TGATCA 1 cut(s) 127
Kzo9I GATC 1 cut(s) 127
LmnI GCTCC 2 cut(s) 94, 100
LpnPI CCDG 2 cut(s) 85, 105
LweI GCATC 2 cut(s) 184, 206
MaeI CTAG 1 cut(s) 108
MaeII ACGT 1 cut(s) 173
MalI GATC 1 cut(s) 129
MboI GATC 1 cut(s) 127
MboII GAAGA 3 cut(s) 192, 195, 211
MnlI CCTC 3 cut(s) 3, 198, 217
Mph1103I ATGCAT 1 cut(s) 199
MreI CGCCGGCG 1 cut(s) 71
MroNI GCCGGC 1 cut(s) 71
MspI CCGG 1 cut(s) 72
MvnI CGCG 1 cut(s) 140
MwoI GCNNNNNNNGC 2 cut(s) 29, 38
NaeI GCCGGC 1 cut(s) 73
NdeII GATC 1 cut(s) 127
NgoMIV GCCGGC 1 cut(s) 71
NsiI ATGCAT 1 cut(s) 199
PcsI WCGNNNNNNNCGW 1 cut(s) 51
PdiI GCCGGC 1 cut(s) 73
PfeI GAWTC 1 cut(s) 135
Sau3AI GATC 1 cut(s) 127
SetI ASST 3 cut(s) 91, 176, 218
SfaNI GCATC 2 cut(s) 184, 206
SgeI CNNG 7 cut(s) 21, 84, 104, 120, 143, 151, 203
SgrAI CRCCGGYG 1 cut(s) 71
SspMI CTAG 1 cut(s) 108
TaiI ACGT 1 cut(s) 176
TaqI TCGA 2 cut(s) 8, 122
TfiI GAWTC 1 cut(s) 135
TspDTI ATGAA 1 cut(s) 173
TspGWI ACGGA 2 cut(s) 7, 129
XspI CTAG 1 cut(s) 108
Zsp2I ATGCAT 1 cut(s) 199
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.