MD02G1048700.v1.1

Arabinogalactan peptide

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
OG0017881
Physical Location & Seq
Forward (+)
3832673 .. 3833826
1154 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1048700.v1.1.491

Sequence Viewer

Length: 183 bp
ATGAACTCAATCAGATCCTGCGCCCTCCCAATCATCGGGTTCATGTTCATGGCCCTCCTCAGCCTCGGCTACGCCCAGGAGGCCCCAGCTCCTTCTCCCACCAGCGACGGCATGGCGATCGATCAGGGAATTGCTTACACGCTTATGATGGTGGCGCTTGCAATTACATACCTCCTGCACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AGP

Protein Analysis

61

Amino Acids

6.39

Weight (kDa)

4.54

Isoelectric Point (pI)

52.51

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AGP PF06376 28 - 60 7.8e-19 Arabinogalactan peptide
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017881)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G46330 AT2G46330 AT3G61640
fragaria_vesca FvH4_1g05040
malus_domestica MD02G1048700.v1.1 MD15G1187000.v1.1
prunus_persica Prupe.7G229500_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0090651
rosa_multiflora Rmu_sc0003952.1_g000006 Rmu_sc0016852.1_g000009
rosa_roxburghii Rroxscaffold_2G00150910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 9
AfiI CCNNNNNNNGG 1 cut(s) 35
AjnI CCWGG 1 cut(s) 75
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
AlwI GGATC 1 cut(s) 9
AlwNI CAGNNNCTG 1 cut(s) 18
AoxI GGCC 2 cut(s) 51, 81
AspLEI GCGC 2 cut(s) 23, 157
AspS9I GGNCC 2 cut(s) 52, 82
BbvCI CCTCAGC 1 cut(s) 59
BccI CCATC 1 cut(s) 142
BceAI ACGGC 1 cut(s) 124
BcgI CGANNNNNNTGC 2 cut(s) 100, 134
BciT130I CCWGG 1 cut(s) 77
BfoI RGCGCY 1 cut(s) 158
BglI GCCNNNNNGGC 1 cut(s) 80
Bme1390I CCNGG 1 cut(s) 77
BmgT120I GGNCC 2 cut(s) 52, 82
BmiI GGNNCC 1 cut(s) 84
BmrFI CCNGG 1 cut(s) 77
Bpu10I CCTNAGC 1 cut(s) 59
Bsa29I ATCGAT 1 cut(s) 120
BsaJI CCNNGG 2 cut(s) 64, 75
Bsc4I CCNNNNNNNGG 1 cut(s) 35
BseBI CCWGG 1 cut(s) 77
BseCI ATCGAT 1 cut(s) 120
BseDI CCNNGG 2 cut(s) 64, 75
BseLI CCNNNNNNNGG 1 cut(s) 35
BseMII CTCAG 1 cut(s) 73
BseRI GAGGAG 1 cut(s) 47
BseYI CCCAGC 1 cut(s) 85
BsgI GTGCAG 1 cut(s) 161
Bsh1285I CGRYCG 1 cut(s) 120
BshFI GGCC 2 cut(s) 53, 83
BshVI ATCGAT 1 cut(s) 120
BsiEI CGRYCG 1 cut(s) 120
BslI CCNNNNNNNGG 1 cut(s) 35
BsnI GGCC 2 cut(s) 53, 83
Bsp143I GATC 3 cut(s) 14, 117, 121
BspANI GGCC 2 cut(s) 53, 83
BspCNI CTCAG 1 cut(s) 72
BspDI ATCGAT 1 cut(s) 120
BspLI GGNNCC 1 cut(s) 84
BspPI GGATC 1 cut(s) 9
BssECI CCNNGG 2 cut(s) 64, 75
BssMI GATC 3 cut(s) 14, 117, 121
Bst2UI CCWGG 1 cut(s) 77
BstC8I GCNNGC 1 cut(s) 159
BstDEI CTNAG 1 cut(s) 59
BstH2I RGCGCY 1 cut(s) 158
BstHHI GCGC 2 cut(s) 23, 157
BstKTI GATC 3 cut(s) 17, 120, 124
BstMBI GATC 3 cut(s) 14, 117, 121
BstMCI CGRYCG 1 cut(s) 120
BstMWI GCNNNNNNNGC 1 cut(s) 80
BstNI CCWGG 1 cut(s) 77
BstSCI CCNGG 1 cut(s) 75
BstX2I RGATCY 1 cut(s) 14
BstYI RGATCY 1 cut(s) 14
Bsu15I ATCGAT 1 cut(s) 120
BsuRI GGCC 2 cut(s) 53, 83
BsuTUI ATCGAT 1 cut(s) 120
BtsIMutI CAGTG 1 cut(s) 178
Cac8I GCNNGC 1 cut(s) 159
CaiI CAGNNNCTG 1 cut(s) 18
CfoI GCGC 2 cut(s) 23, 157
Cfr13I GGNCC 2 cut(s) 52, 82
ClaI ATCGAT 1 cut(s) 120
CviAII CATG 3 cut(s) 43, 49, 112
CviJI RGCY 5 cut(s) 53, 63, 69, 83, 89
CviKI_1 RGCY 5 cut(s) 53, 63, 69, 83, 89
DdeI CTNAG 1 cut(s) 59
DpnI GATC 3 cut(s) 16, 119, 123
DpnII GATC 3 cut(s) 14, 117, 121
EcoO109I RGGNCCY 1 cut(s) 82
EcoRII CCWGG 1 cut(s) 75
FaeI CATG 3 cut(s) 46, 52, 115
FaiI YATR 5 cut(s) 44, 50, 113, 146, 169
FatI CATG 3 cut(s) 42, 48, 111
GlaI GCGC 2 cut(s) 22, 156
GsaI CCCAGC 1 cut(s) 89
HaeII RGCGCY 1 cut(s) 158
HaeIII GGCC 2 cut(s) 53, 83
HhaI GCGC 2 cut(s) 23, 157
Hin1II CATG 3 cut(s) 46, 52, 115
Hin6I GCGC 2 cut(s) 21, 155
HinP1I GCGC 2 cut(s) 21, 155
Hpy188I TCNGA 1 cut(s) 14
Hpy99I CGWCG 1 cut(s) 110
HpyAV CCTTC 1 cut(s) 102
HpyCH4V TGCA 2 cut(s) 161, 178
HpyF10VI GCNNNNNNNGC 1 cut(s) 80
HpyF3I CTNAG 1 cut(s) 59
Hsp92II CATG 3 cut(s) 46, 52, 115
HspAI GCGC 2 cut(s) 21, 155
Kzo9I GATC 3 cut(s) 14, 117, 121
LmnI GCTCC 1 cut(s) 94
LpnPI CCDG 6 cut(s) 31, 62, 89, 99, 110, 115
MalI GATC 3 cut(s) 16, 119, 123
MboI GATC 3 cut(s) 14, 117, 121
MflI RGATCY 1 cut(s) 14
MluCI AATT 2 cut(s) 129, 162
MnlI CCTC 6 cut(s) 35, 65, 68, 73, 74, 182
MslI CAYNNNNRTG 2 cut(s) 47, 143
MspR9I CCNGG 1 cut(s) 77
MvaI CCWGG 1 cut(s) 77
MwoI GCNNNNNNNGC 1 cut(s) 80
NdeII GATC 3 cut(s) 14, 117, 121
NlaIII CATG 3 cut(s) 46, 52, 115
NlaIV GGNNCC 1 cut(s) 84
NmeAIII GCCGAG 1 cut(s) 45
Ple19I CGATCG 1 cut(s) 120
Psp6I CCWGG 1 cut(s) 75
PspFI CCCAGC 1 cut(s) 85
PspGI CCWGG 1 cut(s) 75
PspN4I GGNNCC 1 cut(s) 84
PspPI GGNCC 2 cut(s) 52, 82
PstNI CAGNNNCTG 1 cut(s) 18
PsuI RGATCY 1 cut(s) 14
PvuI CGATCG 1 cut(s) 120
RseI CAYNNNNRTG 2 cut(s) 47, 143
Sau3AI GATC 3 cut(s) 14, 117, 121
Sau96I GGNCC 2 cut(s) 52, 82
ScrFI CCNGG 1 cut(s) 77
SetI ASST 2 cut(s) 91, 174
SmiMI CAYNNNNRTG 2 cut(s) 47, 143
Sse9I AATT 2 cut(s) 129, 162
StyD4I CCNGG 1 cut(s) 75
TaqI TCGA 1 cut(s) 120
TasI AATT 2 cut(s) 129, 162
TspDTI ATGAA 3 cut(s) 17, 31, 37
XcmI CCANNNNNNNNNTGG 1 cut(s) 109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.