AT4G34810

Auxin-induced protein 15A-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
OG0019120
Physical Location & Seq
Forward (+)
16598958 .. 16599568
611 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G34810.1

Sequence Viewer

Length: 357 bp
ATGAAGAAAAAAAAACTTTCATTCAAAGCAAAAAGAAAGATGGGTCTGAGCCGTTTTGCGATATCAAATGCAACAAAGCAGATATTGAAGCTAAACTCATTGGCAAACAGAAACCGAACCTCATCATCATCATCGGATCATGTCCCTAAAGGACACGTAGCAGTTTATGTAGGAGAACAGATTGAGATGGAGAAGAAGAGATTCGTGGTTCCAATATCGTTTCTGAATCATCCTTCCTTCAAAGAGTTCCTTAGTCGAGCAGAGGAAGAGTTTGGATTCAATCATCCAATGGGAGGCTTGACCATTCCTTGTAGAGAAGAAGTTTTTCTTGATCTCATCGCTTCTCGGTTACAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04075 map04075
Pfam Domains
Protein Families
Auxin_inducible

Protein Analysis

118

Amino Acids

13.44

Weight (kDa)

10.12

Isoelectric Point (pI)

47.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 24 - 114 3.6e-26 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019120)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G34790 AT4G34800 AT4G34810
fragaria_vesca FvH4_2g02280
malus_domestica MD05G1113700.v1.1
prunus_persica Prupe.8G158200_v2.0.a1
rosa_chinensis RchiOBHm_Chr6g0245711 RchiOBHm_Chr6g0245761

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 144
AfiI CCNNNNNNNGG 1 cut(s) 293
AflIII ACRYGT 1 cut(s) 154
AgsI TTSAA 4 cut(s) 25, 88, 241, 280
AluBI AGCT 1 cut(s) 91
AluI AGCT 1 cut(s) 91
AlwI GGATC 1 cut(s) 144
Asp700I GAANNNNTTC 2 cut(s) 200, 324
BccI CCATC 2 cut(s) 34, 181
BceAI ACGGC 1 cut(s) 36
BmiI GGNNCC 1 cut(s) 210
BsaAI YACGTR 1 cut(s) 157
Bsc4I CCNNNNNNNGG 1 cut(s) 293
BseGI GGATG 2 cut(s) 229, 283
BseLI CCNNNNNNNGG 1 cut(s) 293
BseMII CTCAG 1 cut(s) 38
BslFI GGGAC 1 cut(s) 128
BslI CCNNNNNNNGG 1 cut(s) 293
BsmFI GGGAC 1 cut(s) 128
Bsp143I GATC 2 cut(s) 136, 331
BspCNI CTCAG 1 cut(s) 39
BspLI GGNNCC 1 cut(s) 210
BspPI GGATC 1 cut(s) 144
BssMI GATC 2 cut(s) 136, 331
Bst6I CTCTTC 2 cut(s) 191, 261
BstBAI YACGTR 1 cut(s) 157
BstDEI CTNAG 2 cut(s) 47, 251
BstF5I GGATG 2 cut(s) 229, 283
BstKTI GATC 2 cut(s) 139, 334
BstMBI GATC 2 cut(s) 136, 331
BtgZI GCGATG 1 cut(s) 322
BtsCI GGATG 2 cut(s) 229, 283
CviAII CATG 1 cut(s) 140
CviJI RGCY 3 cut(s) 51, 91, 297
CviKI_1 RGCY 3 cut(s) 51, 91, 297
DdeI CTNAG 2 cut(s) 47, 251
DpnI GATC 2 cut(s) 138, 333
DpnII GATC 2 cut(s) 136, 331
Eam1104I CTCTTC 2 cut(s) 191, 261
EarI CTCTTC 2 cut(s) 191, 261
Eco32I GATATC 1 cut(s) 63
EcoRV GATATC 1 cut(s) 63
FaeI CATG 1 cut(s) 143
FaiI YATR 2 cut(s) 141, 168
FalI AAGNNNNNCTT 4 cut(s) 234, 266, 312, 344
FaqI GGGAC 1 cut(s) 128
FatI CATG 1 cut(s) 139
FokI GGATG 2 cut(s) 216, 270
Hin1II CATG 1 cut(s) 143
HinfI GANTC 3 cut(s) 201, 226, 276
Hpy188I TCNGA 3 cut(s) 48, 136, 225
Hpy188III TCNNGA 1 cut(s) 329
HpyAV CCTTC 2 cut(s) 243, 247
HpyCH4IV ACGT 1 cut(s) 156
HpyCH4V TGCA 1 cut(s) 71
HpyF3I CTNAG 2 cut(s) 47, 251
HpySE526I ACGT 1 cut(s) 156
Hsp92II CATG 1 cut(s) 143
Kzo9I GATC 2 cut(s) 136, 331
MaeII ACGT 1 cut(s) 156
MaeIII GTNAC 1 cut(s) 348
MalI GATC 2 cut(s) 138, 333
MboI GATC 2 cut(s) 136, 331
MboII GAAGA 5 cut(s) 16, 205, 208, 278, 329
MnlI CCTC 3 cut(s) 130, 256, 287
MroXI GAANNNNTTC 2 cut(s) 200, 324
NdeII GATC 2 cut(s) 136, 331
NlaIII CATG 1 cut(s) 143
NlaIV GGNNCC 1 cut(s) 210
PdmI GAANNNNTTC 2 cut(s) 200, 324
PfeI GAWTC 3 cut(s) 201, 226, 276
Ppu21I YACGTR 1 cut(s) 157
PspN4I GGNNCC 1 cut(s) 210
Sau3AI GATC 2 cut(s) 136, 331
SetI ASST 3 cut(s) 93, 122, 159
SgeI CNNG 7 cut(s) 152, 167, 217, 269, 310, 321, 341
TaiI ACGT 1 cut(s) 159
TaqI TCGA 1 cut(s) 256
TfiI GAWTC 3 cut(s) 201, 226, 276
TspDTI ATGAA 2 cut(s) 9, 17
XmnI GAANNNNTTC 2 cut(s) 200, 324
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.