RchiOBHm_Chr6g0245761

Auxin-induced protein 15A-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0019120
Physical Location & Seq
Forward (+)
1527149 .. 1527448
300 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22027

Sequence Viewer

Length: 300 bp
ATGGGTCCAGTTCGTTTGCCTTCGTTGGTGCAAAATGTGAAGCAAATTTTGAGAGTTAAGTCTCACAACCATGAAGTTCCGAAAGGGCATGTTGCAGTTTATGTGGGAGAGCAAATTGAGAAGAAGAGGTATGTGGTGTCAGTATCTTACTTGAACCACCTTTCATTCAAGGACTTGCTTAAGCGAGCTGAAGATGAGTTTGGCTTCAATCATCCGATGGGCGGTCTCACGATTCCGTGCAGAGAAGAGACCTTTTTTGATCTTATTGCTCCTAAGTTGGGAGCCAGAATACTAAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04075 map04075
Pfam Domains
Protein Families
Auxin_inducible

Protein Analysis

99

Amino Acids

11.24

Weight (kDa)

9.41

Isoelectric Point (pI)

41.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 20 - 89 1.5e-22 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019120)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G34790 AT4G34800 AT4G34810
fragaria_vesca FvH4_2g02280
malus_domestica MD05G1113700.v1.1
prunus_persica Prupe.8G158200_v2.0.a1
rosa_chinensis RchiOBHm_Chr6g0245711 RchiOBHm_Chr6g0245761

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 222
AcsI RAATTY 1 cut(s) 45
AcuI CTGAAG 1 cut(s) 210
AfiI CCNNNNNNNGG 2 cut(s) 221, 278
AflII CTTAAG 1 cut(s) 179
AgsI TTSAA 3 cut(s) 154, 169, 208
AjuI GAANNNNNNNTTGG 2 cut(s) 183, 215
AluBI AGCT 1 cut(s) 188
AluI AGCT 1 cut(s) 188
Alw26I GTCTC 3 cut(s) 66, 230, 242
ApoI RAATTY 1 cut(s) 45
AspS9I GGNCC 1 cut(s) 5
AvaII GGWCC 1 cut(s) 5
BccI CCATC 1 cut(s) 211
BcoDI GTCTC 3 cut(s) 66, 230, 242
BfrI CTTAAG 1 cut(s) 179
Bme18I GGWCC 1 cut(s) 5
BmgT120I GGNCC 1 cut(s) 5
BmiI GGNNCC 2 cut(s) 6, 283
BsaI GGTCTC 2 cut(s) 230, 242
Bsc4I CCNNNNNNNGG 2 cut(s) 221, 278
Bse1I ACTGG 1 cut(s) 8
BseGI GGATG 1 cut(s) 211
BseLI CCNNNNNNNGG 2 cut(s) 221, 278
BseNI ACTGG 1 cut(s) 8
BsgI GTGCAG 1 cut(s) 259
BslI CCNNNNNNNGG 2 cut(s) 221, 278
BsmAI GTCTC 3 cut(s) 66, 230, 242
Bso31I GGTCTC 2 cut(s) 230, 242
Bsp143I GATC 1 cut(s) 259
BspACI CCGC 1 cut(s) 222
BspLI GGNNCC 2 cut(s) 6, 283
BspTI CTTAAG 1 cut(s) 179
BspTNI GGTCTC 2 cut(s) 230, 242
BsrI ACTGG 1 cut(s) 8
BssMI GATC 1 cut(s) 259
Bst6I CTCTTC 2 cut(s) 119, 240
BstAFI CTTAAG 1 cut(s) 179
BstC8I GCNNGC 1 cut(s) 186
BstDEI CTNAG 2 cut(s) 273, 293
BstF5I GGATG 1 cut(s) 211
BstKTI GATC 1 cut(s) 262
BstMAI GTCTC 3 cut(s) 66, 230, 242
BstMBI GATC 1 cut(s) 259
BstNSI RCATGY 1 cut(s) 92
BtsCI GGATG 1 cut(s) 211
Cac8I GCNNGC 1 cut(s) 186
Cfr13I GGNCC 1 cut(s) 5
CviAII CATG 2 cut(s) 71, 89
CviJI RGCY 3 cut(s) 188, 204, 284
CviKI_1 RGCY 3 cut(s) 188, 204, 284
DdeI CTNAG 2 cut(s) 273, 293
DpnI GATC 1 cut(s) 261
DpnII GATC 1 cut(s) 259
Eam1104I CTCTTC 2 cut(s) 119, 240
EarI CTCTTC 2 cut(s) 119, 240
Eco31I GGTCTC 2 cut(s) 230, 242
Eco47I GGWCC 1 cut(s) 5
Eco57I CTGAAG 1 cut(s) 210
FaeI CATG 2 cut(s) 74, 92
FaiI YATR 4 cut(s) 72, 90, 102, 132
FatI CATG 2 cut(s) 70, 88
FokI GGATG 1 cut(s) 198
Hin1II CATG 2 cut(s) 74, 92
HinfI GANTC 1 cut(s) 232
Hpy188I TCNGA 2 cut(s) 81, 216
Hpy188III TCNNGA 1 cut(s) 229
HpyAV CCTTC 1 cut(s) 30
HpyCH4V TGCA 3 cut(s) 31, 95, 240
HpyF3I CTNAG 2 cut(s) 273, 293
Hsp92II CATG 2 cut(s) 74, 92
Kzo9I GATC 1 cut(s) 259
LmnI GCTCC 2 cut(s) 274, 281
LpnPI CCDG 1 cut(s) 21
MalI GATC 1 cut(s) 261
MboI GATC 1 cut(s) 259
MboII GAAGA 4 cut(s) 133, 136, 203, 257
MluCI AATT 2 cut(s) 45, 114
MnlI CCTC 1 cut(s) 120
MseI TTAA 3 cut(s) 57, 180, 298
MslI CAYNNNNRTG 1 cut(s) 69
MspCI CTTAAG 1 cut(s) 179
NdeII GATC 1 cut(s) 259
NlaIII CATG 2 cut(s) 74, 92
NlaIV GGNNCC 2 cut(s) 6, 283
NspI RCATGY 1 cut(s) 92
PfeI GAWTC 1 cut(s) 232
PspN4I GGNNCC 2 cut(s) 6, 283
PspPI GGNCC 1 cut(s) 5
RseI CAYNNNNRTG 1 cut(s) 69
SaqAI TTAA 3 cut(s) 57, 180, 298
Sau3AI GATC 1 cut(s) 259
Sau96I GGNCC 1 cut(s) 5
SetI ASST 4 cut(s) 131, 162, 190, 254
SgeI CNNG 9 cut(s) 20, 83, 101, 163, 181, 187, 197, 241, 249
SinI GGWCC 1 cut(s) 5
SmiMI CAYNNNNRTG 1 cut(s) 69
SmlI CTYRAG 1 cut(s) 179
SmoI CTYRAG 1 cut(s) 179
Sse9I AATT 2 cut(s) 45, 114
SsiI CCGC 1 cut(s) 222
TasI AATT 2 cut(s) 45, 114
TfiI GAWTC 1 cut(s) 232
Tru1I TTAA 3 cut(s) 57, 180, 298
Tru9I TTAA 3 cut(s) 57, 180, 298
TspDTI ATGAA 2 cut(s) 87, 153
TspGWI ACGGA 1 cut(s) 225
Vha464I CTTAAG 1 cut(s) 179
VpaK11BI GGWCC 1 cut(s) 5
XapI RAATTY 1 cut(s) 45
XceI RCATGY 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.