MD05G1113700.v1.1

Auxin responsive protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0019120
Physical Location & Seq
Forward (+)
23253593 .. 23253868
276 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1113700.v1.1.491

Sequence Viewer

Length: 276 bp
ATGGGTATGATGAAGCACATTCTCAAACTGCAGTCTAGGTCGTCATTTCATGAAGTCCCGAAAGGCCATGTTGCAGTTTATGTTGGAGAATTTGGAAAGAAGAGGTATGTGGTTCCAGTGGCTTACTTGAACCATCCTTCGTTTAAGGTCCTGCTTAAGAGCGCAGAAGAAGAGTTTGGCTTCAACCATCCAATGGGGGGTCTAATAATTCCATGCAAAGAAGAGACTTTCATTAGTCTCATTTACGAGCTGGGAATTGCCAGATTACAAAGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04075 map04075
Pfam Domains
Protein Families
Auxin_inducible

Protein Analysis

92

Amino Acids

10.38

Weight (kDa)

9.37

Isoelectric Point (pI)

48.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 12 - 81 2.8e-23 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019120)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G34790 AT4G34800 AT4G34810
fragaria_vesca FvH4_2g02280
malus_domestica MD05G1113700.v1.1
prunus_persica Prupe.8G158200_v2.0.a1
rosa_chinensis RchiOBHm_Chr6g0245711 RchiOBHm_Chr6g0245761

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 193
AcsI RAATTY 1 cut(s) 89
AfiI CCNNNNNNNGG 2 cut(s) 193, 197
AflII CTTAAG 1 cut(s) 155
AgsI TTSAA 2 cut(s) 130, 184
AjuI GAANNNNNNNTTGG 2 cut(s) 159, 191
AluBI AGCT 1 cut(s) 250
AluI AGCT 1 cut(s) 250
Alw26I GTCTC 2 cut(s) 218, 242
AoxI GGCC 1 cut(s) 64
ApoI RAATTY 1 cut(s) 89
AspLEI GCGC 1 cut(s) 164
AspS9I GGNCC 1 cut(s) 148
AvaII GGWCC 1 cut(s) 148
BccI CCATC 2 cut(s) 141, 195
BcoDI GTCTC 2 cut(s) 218, 242
BfaI CTAG 1 cut(s) 36
BfmI CTRYAG 1 cut(s) 29
BfrI CTTAAG 1 cut(s) 155
Bme18I GGWCC 1 cut(s) 148
BmgT120I GGNCC 1 cut(s) 148
BmiI GGNNCC 1 cut(s) 114
Bsc4I CCNNNNNNNGG 2 cut(s) 193, 197
Bse1I ACTGG 1 cut(s) 116
BseGI GGATG 2 cut(s) 133, 187
BseLI CCNNNNNNNGG 2 cut(s) 193, 197
BseNI ACTGG 1 cut(s) 116
BseYI CCCAGC 1 cut(s) 250
BshFI GGCC 1 cut(s) 66
BslFI GGGAC 1 cut(s) 41
BslI CCNNNNNNNGG 2 cut(s) 193, 197
BsmAI GTCTC 2 cut(s) 218, 242
BsmFI GGGAC 1 cut(s) 41
BsnI GGCC 1 cut(s) 66
BspANI GGCC 1 cut(s) 66
BspHI TCATGA 1 cut(s) 49
BspLI GGNNCC 1 cut(s) 114
BspMAI CTGCAG 1 cut(s) 33
BspTI CTTAAG 1 cut(s) 155
BsrI ACTGG 1 cut(s) 116
Bst6I CTCTTC 3 cut(s) 95, 165, 216
BstAFI CTTAAG 1 cut(s) 155
BstF5I GGATG 2 cut(s) 133, 187
BstHHI GCGC 1 cut(s) 164
BstMAI GTCTC 2 cut(s) 218, 242
BstSFI CTRYAG 1 cut(s) 29
BsuRI GGCC 1 cut(s) 66
BtsCI GGATG 2 cut(s) 133, 187
BtsIMutI CAGTG 1 cut(s) 123
CciI TCATGA 1 cut(s) 49
CfoI GCGC 1 cut(s) 164
Cfr13I GGNCC 1 cut(s) 148
CviAII CATG 3 cut(s) 50, 68, 213
CviJI RGCY 4 cut(s) 66, 122, 180, 250
CviKI_1 RGCY 4 cut(s) 66, 122, 180, 250
Eam1104I CTCTTC 3 cut(s) 95, 165, 216
EarI CTCTTC 3 cut(s) 95, 165, 216
Eco47I GGWCC 1 cut(s) 148
EcoO109I RGGNCCY 1 cut(s) 148
FaeI CATG 3 cut(s) 53, 71, 216
FaiI YATR 6 cut(s) 8, 51, 69, 81, 108, 214
FaqI GGGAC 1 cut(s) 41
FatI CATG 3 cut(s) 49, 67, 212
FokI GGATG 2 cut(s) 120, 174
FspBI CTAG 1 cut(s) 36
GlaI GCGC 1 cut(s) 163
GsaI CCCAGC 1 cut(s) 254
HaeIII GGCC 1 cut(s) 66
HhaI GCGC 1 cut(s) 164
Hin1II CATG 3 cut(s) 53, 71, 216
Hin6I GCGC 1 cut(s) 162
HinP1I GCGC 1 cut(s) 162
Hpy188III TCNNGA 2 cut(s) 50, 58
HpyAV CCTTC 1 cut(s) 147
HpyCH4V TGCA 3 cut(s) 31, 74, 216
Hsp92II CATG 3 cut(s) 53, 71, 216
HspAI GCGC 1 cut(s) 162
LpnPI CCDG 3 cut(s) 129, 164, 236
MaeI CTAG 1 cut(s) 36
MboII GAAGA 4 cut(s) 112, 179, 182, 233
MluCI AATT 3 cut(s) 89, 207, 255
MmeI TCCRAC 1 cut(s) 64
MnlI CCTC 1 cut(s) 96
MseI TTAA 2 cut(s) 144, 156
MspCI CTTAAG 1 cut(s) 155
NlaIII CATG 3 cut(s) 53, 71, 216
NlaIV GGNNCC 1 cut(s) 114
PagI TCATGA 1 cut(s) 49
PflMI CCANNNNNTGG 1 cut(s) 193
PpuMI RGGWCCY 1 cut(s) 148
Psp5II RGGWCCY 1 cut(s) 148
PspFI CCCAGC 1 cut(s) 250
PspN4I GGNNCC 1 cut(s) 114
PspPI GGNCC 1 cut(s) 148
PspPPI RGGWCCY 1 cut(s) 148
PstI CTGCAG 1 cut(s) 33
SaqAI TTAA 2 cut(s) 144, 156
Sau96I GGNCC 1 cut(s) 148
SetI ASST 4 cut(s) 41, 107, 150, 252
SfcI CTRYAG 1 cut(s) 29
SinI GGWCC 1 cut(s) 148
SmlI CTYRAG 1 cut(s) 155
SmoI CTYRAG 1 cut(s) 155
Sse9I AATT 3 cut(s) 89, 207, 255
SspMI CTAG 1 cut(s) 36
TasI AATT 3 cut(s) 89, 207, 255
Tru1I TTAA 2 cut(s) 144, 156
Tru9I TTAA 2 cut(s) 144, 156
TscAI CASTG 1 cut(s) 123
TspDTI ATGAA 4 cut(s) 26, 38, 66, 220
TspRI CASTG 1 cut(s) 123
Van91I CCANNNNNTGG 1 cut(s) 193
Vha464I CTTAAG 1 cut(s) 155
VpaK11BI GGWCC 1 cut(s) 148
XapI RAATTY 1 cut(s) 89
XspI CTAG 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.