ATCG00530

May be involved in proton extrusion. Indirectly promotes efficient inorganic carbon uptake

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
Pt
OG0019581
Physical Location & Seq
Forward (+)
60741 .. 61430
690 bp
Loading structure...
UTR
Exon/CDS
Intron
ATCG00530.1

Sequence Viewer

Length: 690 bp
ATGGCAAAAAAGAAAGCATTCATTCCTTTTTTTTATTTTCTATCTATAGTCTTTTTGCCCTGGTTGATCTCTCTCTGCTGTAATAAAAGTTTGAAAACTTGGATTACTAATTGGTGGAATACTAGACAATGCGAAACTTTTTTGAATGATATTCAAGAAAAAAGTTTTCTAGAAAAATTCATACAATTAGAGGAACTATTCCAGCTCGATGAAATGATAAAGGAATACCCAGAAACCAATTTACAACAATTTCGTCTAGGAATCCACAAAGAAACGATCCAATTCATCAAGATACACAATGAGTATAATATCCATACAATCTTGCACTTCTCGACAAATCTAATATCTTTCGTTATTCTAAGTGGTTATTCCTTTTGGGGTAAGGAAAAGCTTTTTATTCTGAATTCTTGGGTTCAAGAATTCCTATATAATTTAAGTGATACAATTAAAGCTTTTTCGATTCTTTTATTAACTGATTTATGTATCGGATTCCATTCGCCTCACGGTTGGGAACTAATGATTGGTTATATTTACAAAGATTTTGGGTTTGCTCATTATGAGCAAATTTTATCTGGTCTAGTTTCTACCTTTCCAGTAATTCTTGATACAATTTTTAAATATTGGATTTTTCGTTATTTAAATCGTGTATCTCCGTCACTTGTAGTGATTTATCATGCAATAAACGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CemA

Protein Analysis

229

Amino Acids

27.4

Weight (kDa)

6.44

Isoelectric Point (pI)

30.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CemA PF03040 3 - 229 1.8e-76 CemA family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019581)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00530
fragaria_vesca FvH4_3g27991
malus_domestica MD08G1223200.v1.1
prunus_persica Prupe.7G029500_v2.0.a1
pyrus_communis pycom04g07520 pycom12397g00230
rosa_chinensis RchiOBHm_CPg0502081

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 271
AcsI RAATTY 4 cut(s) 176, 403, 419, 564
AgsI TTSAA 4 cut(s) 94, 145, 155, 416
AjnI CCWGG 1 cut(s) 59
AjuI GAANNNNNNNTTGG 2 cut(s) 504, 536
AluBI AGCT 3 cut(s) 205, 391, 452
AluI AGCT 3 cut(s) 205, 391, 452
AlwI GGATC 1 cut(s) 271
ApoI RAATTY 4 cut(s) 176, 403, 419, 564
Asp700I GAANNNNTTC 1 cut(s) 17
BciT130I CCWGG 1 cut(s) 61
BfaI CTAG 4 cut(s) 123, 170, 257, 578
BfmI CTRYAG 1 cut(s) 45
Bme1390I CCNGG 1 cut(s) 61
BmrFI CCNGG 1 cut(s) 61
BsaJI CCNNGG 1 cut(s) 59
Bse1I ACTGG 1 cut(s) 593
BseBI CCWGG 1 cut(s) 61
BseDI CCNNGG 1 cut(s) 59
BseNI ACTGG 1 cut(s) 593
BsmI GAATGC 1 cut(s) 17
Bsp143I GATC 2 cut(s) 66, 276
BspPI GGATC 1 cut(s) 271
BsrI ACTGG 1 cut(s) 593
BssECI CCNNGG 1 cut(s) 59
BssMI GATC 2 cut(s) 66, 276
Bst2UI CCWGG 1 cut(s) 61
Bst4CI ACNGT 1 cut(s) 506
BstDEI CTNAG 1 cut(s) 359
BstKTI GATC 2 cut(s) 69, 279
BstMBI GATC 2 cut(s) 66, 276
BstNI CCWGG 1 cut(s) 61
BstSCI CCNGG 1 cut(s) 59
BstSFI CTRYAG 1 cut(s) 45
CviAII CATG 1 cut(s) 674
CviJI RGCY 3 cut(s) 205, 391, 452
CviKI_1 RGCY 3 cut(s) 205, 391, 452
DdeI CTNAG 1 cut(s) 359
DpnI GATC 2 cut(s) 68, 278
DpnII GATC 2 cut(s) 66, 276
DraI TTTAAA 2 cut(s) 616, 639
EcoRI GAATTC 2 cut(s) 403, 419
EcoRII CCWGG 1 cut(s) 59
FaeI CATG 1 cut(s) 677
FatI CATG 1 cut(s) 673
FspBI CTAG 4 cut(s) 123, 170, 257, 578
Hin1II CATG 1 cut(s) 677
HindIII AAGCTT 2 cut(s) 389, 450
HinfI GANTC 3 cut(s) 261, 460, 489
Hpy188I TCNGA 2 cut(s) 402, 488
Hpy188III TCNNGA 6 cut(s) 155, 170, 289, 331, 416, 602
HpyCH4III ACNGT 1 cut(s) 506
HpyCH4V TGCA 2 cut(s) 325, 677
HpyF3I CTNAG 1 cut(s) 359
Hsp92II CATG 1 cut(s) 677
Kzo9I GATC 2 cut(s) 66, 276
LpnPI CCDG 6 cut(s) 46, 73, 215, 243, 558, 606
MaeI CTAG 4 cut(s) 123, 170, 257, 578
MaeIII GTNAC 1 cut(s) 654
MalI GATC 2 cut(s) 68, 278
MboI GATC 2 cut(s) 66, 276
MnlI CCTC 2 cut(s) 184, 510
MroXI GAANNNNTTC 1 cut(s) 17
MseI TTAA 5 cut(s) 434, 447, 470, 615, 638
MspR9I CCNGG 1 cut(s) 61
Mva1269I GAATGC 1 cut(s) 17
MvaI CCWGG 1 cut(s) 61
NdeII GATC 2 cut(s) 66, 276
NlaIII CATG 1 cut(s) 677
NmuCI GTSAC 1 cut(s) 654
PctI GAATGC 1 cut(s) 17
PdmI GAANNNNTTC 1 cut(s) 17
PfeI GAWTC 3 cut(s) 261, 460, 489
Psp6I CCWGG 1 cut(s) 59
PspGI CCWGG 1 cut(s) 59
SaqAI TTAA 5 cut(s) 434, 447, 470, 615, 638
Sau3AI GATC 2 cut(s) 66, 276
ScrFI CCNGG 1 cut(s) 61
SetI ASST 4 cut(s) 207, 393, 454, 590
SfcI CTRYAG 1 cut(s) 45
SmiI ATTTAAAT 1 cut(s) 639
SspI AATATT 1 cut(s) 620
SspMI CTAG 4 cut(s) 123, 170, 257, 578
StyD4I CCNGG 1 cut(s) 59
SwaI ATTTAAAT 1 cut(s) 639
TaaI ACNGT 1 cut(s) 506
TaqI TCGA 3 cut(s) 207, 332, 458
TfiI GAWTC 3 cut(s) 261, 460, 489
Tru1I TTAA 5 cut(s) 434, 447, 470, 615, 638
Tru9I TTAA 5 cut(s) 434, 447, 470, 615, 638
TseFI GTSAC 1 cut(s) 654
Tsp45I GTSAC 1 cut(s) 654
TspDTI ATGAA 4 cut(s) 10, 169, 225, 274
TspGWI ACGGA 1 cut(s) 642
XapI RAATTY 4 cut(s) 176, 403, 419, 564
XbaI TCTAGA 1 cut(s) 169
XmnI GAANNNNTTC 1 cut(s) 17
XspI CTAG 4 cut(s) 123, 170, 257, 578
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.