FvH4_3g27991

May be involved in proton extrusion. Indirectly promotes efficient inorganic carbon uptake

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
OG0019581
Physical Location & Seq
Reverse (-)
21013586 .. 21014453
868 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g27991.t1

Sequence Viewer

Length: 525 bp
ATGACAATGAGATTTGGGAGCTTTTACAAAACATCACATAAGTCGATTATGCTTTTTCAAGCTTTTGCAAGTACAAGTCTAAATAGGTTGATGTTATTGACATACTTATTAATATACTTATTGATGGTGCACAATGAGGATTGTATCCATACAATTTTACACTTCTCGACAAATATAATCTGTTTCGTTATTCTAAGTGGTTATTCTATTCTAGGTAATGAAGAACTTGTTATTCTTAACTCTTGGGTTCAAGAATTCCTATATAACTTAAGCGACACAATAAAAGCTTTTTCTATTCTTTTATTAACTGATTTATGTATAGGATTCCATTCGCCCCACGGTTGGGAATTAATGATTGGCTCTGTCTACAAAGATTTTGGATTTGCTCATAATGATCAAATTATATCCGGTCTTGTTTCTACTTTTCCAGTCATTTTAGATACAATTTTTAAATATTGGATCTTTCGTTATTTAAATCGTGTATCTCCTTCACTTGTGGTGATTTATCATTCAATGAATGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CemA

Protein Analysis

175

Amino Acids

20.14

Weight (kDa)

6.2

Isoelectric Point (pI)

30.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CemA PF03040 43 - 174 4.7e-57 CemA family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019581)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00530
fragaria_vesca FvH4_3g27991
malus_domestica MD08G1223200.v1.1
prunus_persica Prupe.7G029500_v2.0.a1
pyrus_communis pycom04g07520 pycom12397g00230
rosa_chinensis RchiOBHm_CPg0502081

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 366
AclWI GGATC 1 cut(s) 467
AcsI RAATTY 1 cut(s) 254
AfaI GTAC 1 cut(s) 73
AfiI CCNNNNNNNGG 2 cut(s) 342, 343
AflII CTTAAG 1 cut(s) 268
AgsI TTSAA 3 cut(s) 59, 251, 513
AjuI GAANNNNNNNTTGG 2 cut(s) 339, 371
AluBI AGCT 3 cut(s) 21, 62, 287
AluI AGCT 3 cut(s) 21, 62, 287
Alw21I GWGCWC 1 cut(s) 132
Alw44I GTGCAC 1 cut(s) 128
AlwI GGATC 1 cut(s) 467
ApaLI GTGCAC 1 cut(s) 128
ApoI RAATTY 1 cut(s) 254
AseI ATTAAT 2 cut(s) 110, 350
AsuHPI GGTGA 1 cut(s) 511
BaeGI GKGCMC 1 cut(s) 132
Bbv12I GWGCWC 1 cut(s) 132
BccI CCATC 1 cut(s) 118
BciVI GTATCC 1 cut(s) 155
BclI TGATCA 1 cut(s) 394
BfaI CTAG 1 cut(s) 212
BfrI CTTAAG 1 cut(s) 268
BfuI GTATCC 1 cut(s) 155
BsaJI CCNNGG 1 cut(s) 337
BsaWI WCCGGW 1 cut(s) 407
Bsc4I CCNNNNNNNGG 2 cut(s) 342, 343
Bse1I ACTGG 1 cut(s) 428
BseDI CCNNGG 1 cut(s) 337
BseLI CCNNNNNNNGG 2 cut(s) 342, 343
BseNI ACTGG 1 cut(s) 428
BseSI GKGCMC 1 cut(s) 132
BsiHKAI GWGCWC 1 cut(s) 132
BsiSI CCGG 1 cut(s) 408
BslI CCNNNNNNNGG 2 cut(s) 342, 343
Bsp1286I GDGCHC 1 cut(s) 132
Bsp143I GATC 2 cut(s) 394, 459
BspPI GGATC 1 cut(s) 467
BspTI CTTAAG 1 cut(s) 268
BsrI ACTGG 1 cut(s) 428
BssECI CCNNGG 1 cut(s) 337
BssMI GATC 2 cut(s) 394, 459
Bst4CI ACNGT 1 cut(s) 341
BstAFI CTTAAG 1 cut(s) 268
BstDEI CTNAG 1 cut(s) 194
BstDSI CCRYGG 1 cut(s) 337
BstKTI GATC 2 cut(s) 397, 462
BstMBI GATC 2 cut(s) 394, 459
BstSLI GKGCMC 1 cut(s) 132
BstX2I RGATCY 1 cut(s) 459
BstYI RGATCY 1 cut(s) 459
BsuI GTATCC 1 cut(s) 155
BtgI CCRYGG 1 cut(s) 337
Csp6I GTAC 1 cut(s) 72
CviJI RGCY 4 cut(s) 21, 62, 287, 360
CviKI_1 RGCY 4 cut(s) 21, 62, 287, 360
CviQI GTAC 1 cut(s) 72
DdeI CTNAG 1 cut(s) 194
DpnI GATC 2 cut(s) 396, 461
DpnII GATC 2 cut(s) 394, 459
DraI TTTAAA 2 cut(s) 451, 474
EcoRI GAATTC 1 cut(s) 254
FbaI TGATCA 1 cut(s) 394
FblI GTMKAC 1 cut(s) 366
FspBI CTAG 1 cut(s) 212
HapII CCGG 1 cut(s) 408
HindIII AAGCTT 2 cut(s) 60, 285
HinfI GANTC 1 cut(s) 324
HpaII CCGG 1 cut(s) 408
HphI GGTGA 1 cut(s) 511
Hpy166II GTNNAC 2 cut(s) 130, 367
Hpy188III TCNNGA 2 cut(s) 166, 251
Hpy8I GTNNAC 2 cut(s) 130, 367
HpyAV CCTTC 1 cut(s) 498
HpyCH4III ACNGT 1 cut(s) 341
HpyCH4V TGCA 2 cut(s) 68, 130
HpyF3I CTNAG 1 cut(s) 194
Ksp22I TGATCA 1 cut(s) 394
Kzo9I GATC 2 cut(s) 394, 459
LmnI GCTCC 1 cut(s) 18
LpnPI CCDG 2 cut(s) 421, 441
MaeI CTAG 1 cut(s) 212
MalI GATC 2 cut(s) 396, 461
MboI GATC 2 cut(s) 394, 459
MboII GAAGA 1 cut(s) 233
MflI RGATCY 1 cut(s) 459
MhlI GDGCHC 1 cut(s) 132
MluCI AATT 5 cut(s) 153, 254, 347, 399, 444
MnlI CCTC 1 cut(s) 130
MseI TTAA 7 cut(s) 110, 237, 269, 305, 350, 450, 473
MspCI CTTAAG 1 cut(s) 268
MspI CCGG 1 cut(s) 408
NdeII GATC 2 cut(s) 394, 459
PfeI GAWTC 1 cut(s) 324
PshBI ATTAAT 2 cut(s) 110, 350
PsuI RGATCY 1 cut(s) 459
RsaI GTAC 1 cut(s) 73
RsaNI GTAC 1 cut(s) 72
SaqAI TTAA 7 cut(s) 110, 237, 269, 305, 350, 450, 473
Sau3AI GATC 2 cut(s) 394, 459
SduI GDGCHC 1 cut(s) 132
SetI ASST 5 cut(s) 23, 64, 89, 217, 289
SmiI ATTTAAAT 1 cut(s) 474
SmlI CTYRAG 1 cut(s) 268
SmoI CTYRAG 1 cut(s) 268
Sse9I AATT 5 cut(s) 153, 254, 347, 399, 444
SspI AATATT 1 cut(s) 455
SspMI CTAG 1 cut(s) 212
SwaI ATTTAAAT 1 cut(s) 474
TaaI ACNGT 1 cut(s) 341
TaqI TCGA 2 cut(s) 44, 167
TasI AATT 5 cut(s) 153, 254, 347, 399, 444
TatI WGTACW 1 cut(s) 71
TfiI GAWTC 1 cut(s) 324
Tru1I TTAA 7 cut(s) 110, 237, 269, 305, 350, 450, 473
Tru9I TTAA 7 cut(s) 110, 237, 269, 305, 350, 450, 473
TspDTI ATGAA 1 cut(s) 234
Vha464I CTTAAG 1 cut(s) 268
VneI GTGCAC 1 cut(s) 128
VspI ATTAAT 2 cut(s) 110, 350
XapI RAATTY 1 cut(s) 254
XmiI GTMKAC 1 cut(s) 366
XspI CTAG 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.