pycom04g07520

May be involved in proton extrusion. Indirectly promotes efficient inorganic carbon uptake

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
OG0019581
Physical Location & Seq
Reverse (-)
8208625 .. 8209314
690 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g07520.1

Sequence Viewer

Length: 690 bp
ATGGCAAAAAAGAAAGTATTAATTTCCCTTCTATATCTTGCATCTATAGTATTTTTGCCTTGGTGGATCTCTCTCTCATTTAATAAAAGTCTAGAATCTTGGTTTACTAATTGGTGGAATACTAGGCAATCCGAAATTTTTTTGAATGATATTCAAGAAAAGAGTATTCTAAAAGAATTCATAGACTTAGAGGAACTCTTACGTTTGGACGAAATGATAAAGGAATACCCGGAAACACATTTACAAAAGCCTCGCATCGAAATCTACAAAGAAACGATCCAATTGATCAAGATGCACAACGAGGATCGCATCCATACAATTTTACACTTCTCGACAAATATAATCTGTTTCGGTATTCTAAGTGGTTATTCTATTCTAGGTAATGAAGAACTTGTTATTCTTAACTCTTGGTTTCAAGAATTCCTATACAACTTAAGCGACACAATAAAAGCTTTTTCTATTCTTTTATTAACGGATTTATGTATAGGATTCCATTCGCCCCACGGTTGGGAATTAATGATTGGCTCTGTCTACAAAGATTTTGGATTTGCTCATAATGATCAAATTATATCCGGTCTTGTTTCTACTTTTCCAGTCATTTTAGATACAATTTTTAAATATTGGATCTTTCGTTATTTAAATCGTGTATCTCCTTCACTTGTAGTGATTTATCATTCAATGAATGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CemA

Protein Analysis

230

Amino Acids

27.09

Weight (kDa)

5.6

Isoelectric Point (pI)

40.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CemA PF03040 3 - 229 1.5e-82 CemA family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019581)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00530
fragaria_vesca FvH4_3g27991
malus_domestica MD08G1223200.v1.1
prunus_persica Prupe.7G029500_v2.0.a1
pyrus_communis pycom04g07520 pycom12397g00230
rosa_chinensis RchiOBHm_CPg0502081

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 531
AclWI GGATC 4 cut(s) 74, 271, 312, 632
AcsI RAATTY 3 cut(s) 135, 176, 419
AfiI CCNNNNNNNGG 2 cut(s) 507, 508
AflII CTTAAG 1 cut(s) 433
AgsI TTSAA 4 cut(s) 145, 155, 416, 678
AjuI GAANNNNNNNTTGG 2 cut(s) 504, 536
AluBI AGCT 1 cut(s) 452
AluI AGCT 1 cut(s) 452
AlwI GGATC 4 cut(s) 74, 271, 312, 632
ApoI RAATTY 3 cut(s) 135, 176, 419
AseI ATTAAT 2 cut(s) 20, 515
AsuC2I CCSGG 1 cut(s) 230
BclI TGATCA 2 cut(s) 285, 559
BcnI CCSGG 1 cut(s) 230
BfaI CTAG 3 cut(s) 92, 123, 377
BfmI CTRYAG 1 cut(s) 45
BfrI CTTAAG 1 cut(s) 433
Bme1390I CCNGG 1 cut(s) 230
BmrFI CCNGG 1 cut(s) 230
BmsI GCATC 4 cut(s) 50, 264, 282, 318
BpuMI CCSGG 1 cut(s) 230
BsaJI CCNNGG 2 cut(s) 59, 502
BsaWI WCCGGW 1 cut(s) 572
Bsc4I CCNNNNNNNGG 2 cut(s) 507, 508
Bse1I ACTGG 1 cut(s) 593
BseDI CCNNGG 2 cut(s) 59, 502
BseGI GGATG 1 cut(s) 309
BseLI CCNNNNNNNGG 2 cut(s) 507, 508
BseNI ACTGG 1 cut(s) 593
BsiSI CCGG 2 cut(s) 230, 573
BslI CCNNNNNNNGG 2 cut(s) 507, 508
Bsp143I GATC 6 cut(s) 66, 276, 285, 304, 559, 624
BspPI GGATC 4 cut(s) 74, 271, 312, 632
BspTI CTTAAG 1 cut(s) 433
BsrI ACTGG 1 cut(s) 593
BssECI CCNNGG 2 cut(s) 59, 502
BssMI GATC 6 cut(s) 66, 276, 285, 304, 559, 624
BssT1I CCWWGG 1 cut(s) 59
Bst4CI ACNGT 1 cut(s) 506
BstAFI CTTAAG 1 cut(s) 433
BstDEI CTNAG 2 cut(s) 187, 359
BstDSI CCRYGG 1 cut(s) 502
BstF5I GGATG 1 cut(s) 309
BstKTI GATC 6 cut(s) 69, 279, 288, 307, 562, 627
BstMBI GATC 6 cut(s) 66, 276, 285, 304, 559, 624
BstSCI CCNGG 1 cut(s) 228
BstSFI CTRYAG 1 cut(s) 45
BstX2I RGATCY 2 cut(s) 66, 624
BstYI RGATCY 2 cut(s) 66, 624
BtgI CCRYGG 1 cut(s) 502
BtsCI GGATG 1 cut(s) 309
CviJI RGCY 3 cut(s) 250, 452, 525
CviKI_1 RGCY 3 cut(s) 250, 452, 525
DdeI CTNAG 2 cut(s) 187, 359
DpnI GATC 6 cut(s) 68, 278, 287, 306, 561, 626
DpnII GATC 6 cut(s) 66, 276, 285, 304, 559, 624
DraI TTTAAA 2 cut(s) 616, 639
Eco130I CCWWGG 1 cut(s) 59
EcoRI GAATTC 2 cut(s) 176, 419
EcoT14I CCWWGG 1 cut(s) 59
ErhI CCWWGG 1 cut(s) 59
FbaI TGATCA 2 cut(s) 285, 559
FblI GTMKAC 1 cut(s) 531
FokI GGATG 1 cut(s) 296
FspBI CTAG 3 cut(s) 92, 123, 377
HapII CCGG 2 cut(s) 230, 573
HindIII AAGCTT 1 cut(s) 450
HinfI GANTC 2 cut(s) 95, 489
HpaII CCGG 2 cut(s) 230, 573
Hpy166II GTNNAC 2 cut(s) 105, 532
Hpy188I TCNGA 1 cut(s) 133
Hpy188III TCNNGA 5 cut(s) 92, 155, 289, 331, 416
Hpy8I GTNNAC 2 cut(s) 105, 532
HpyAV CCTTC 2 cut(s) 38, 663
HpyCH4III ACNGT 1 cut(s) 506
HpyCH4IV ACGT 1 cut(s) 202
HpyCH4V TGCA 2 cut(s) 41, 295
HpyF3I CTNAG 2 cut(s) 187, 359
HpySE526I ACGT 1 cut(s) 202
Ksp22I TGATCA 2 cut(s) 285, 559
Kzo9I GATC 6 cut(s) 66, 276, 285, 304, 559, 624
LpnPI CCDG 3 cut(s) 243, 586, 606
LweI GCATC 4 cut(s) 50, 264, 282, 318
MaeI CTAG 3 cut(s) 92, 123, 377
MaeII ACGT 1 cut(s) 202
MalI GATC 6 cut(s) 68, 278, 287, 306, 561, 626
MboI GATC 6 cut(s) 66, 276, 285, 304, 559, 624
MboII GAAGA 1 cut(s) 398
MfeI CAATTG 1 cut(s) 281
MflI RGATCY 2 cut(s) 66, 624
MnlI CCTC 3 cut(s) 184, 261, 295
MseI TTAA 8 cut(s) 20, 81, 402, 434, 470, 515, 615, 638
MspCI CTTAAG 1 cut(s) 433
MspI CCGG 2 cut(s) 230, 573
MspR9I CCNGG 1 cut(s) 230
MunI CAATTG 1 cut(s) 281
NciI CCSGG 1 cut(s) 230
NdeII GATC 6 cut(s) 66, 276, 285, 304, 559, 624
PfeI GAWTC 2 cut(s) 95, 489
PshBI ATTAAT 2 cut(s) 20, 515
PsuI RGATCY 2 cut(s) 66, 624
SaqAI TTAA 8 cut(s) 20, 81, 402, 434, 470, 515, 615, 638
Sau3AI GATC 6 cut(s) 66, 276, 285, 304, 559, 624
ScrFI CCNGG 1 cut(s) 230
SetI ASST 3 cut(s) 205, 382, 454
SfaNI GCATC 4 cut(s) 50, 264, 282, 318
SfcI CTRYAG 1 cut(s) 45
SmiI ATTTAAAT 1 cut(s) 639
SmlI CTYRAG 1 cut(s) 433
SmoI CTYRAG 1 cut(s) 433
SspI AATATT 1 cut(s) 620
SspMI CTAG 3 cut(s) 92, 123, 377
StyD4I CCNGG 1 cut(s) 228
StyI CCWWGG 1 cut(s) 59
SwaI ATTTAAAT 1 cut(s) 639
TaaI ACNGT 1 cut(s) 506
TaiI ACGT 1 cut(s) 205
TaqI TCGA 2 cut(s) 258, 332
TfiI GAWTC 2 cut(s) 95, 489
Tru1I TTAA 8 cut(s) 20, 81, 402, 434, 470, 515, 615, 638
Tru9I TTAA 8 cut(s) 20, 81, 402, 434, 470, 515, 615, 638
TspDTI ATGAA 2 cut(s) 169, 399
TspGWI ACGGA 1 cut(s) 488
Vha464I CTTAAG 1 cut(s) 433
VspI ATTAAT 2 cut(s) 20, 515
XapI RAATTY 3 cut(s) 135, 176, 419
XbaI TCTAGA 1 cut(s) 91
XmiI GTMKAC 1 cut(s) 531
XspI CTAG 3 cut(s) 92, 123, 377
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.