Prupe.7G029500_v2.0.a1

CemA family

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Forward (+)
5476279 .. 5477596
1318 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G029500.1

Sequence Viewer

Length: 477 bp
ATGTTAAAGGAATACCCGGAAGCACATTTACAAAAGCCTCGCATCAAAATCTACAAAGAAACGATCCAATTGATCAAGATGCACAATGAGGATCGCACGCATACAATTTTACACTTCTCGACAAATATAATCTGTTTTGTTATTCTAAGTGGTTATTCTATTATAGGTAATGAAGAACTTGTTATTCTTAACTCTTGGGTTCAAGAATTCCTATATAACTTAAGCGACACAATAAAAGCTTTTTCTATTCTTTTATTAACTGATTTATGTATAGGATTCCATTCGCCCCACGGTTGGGAACTAATGATTGGCTCTGTCTACAAAGATTTTGGATTTGCTCATAATGATCAAATTATATCCGGTCTTGTTTCTACTTTTCCAGTCATTTTAGATACAATTTTTAAATATTGGATCTTTCGTTATTTAAATCGTGTATCTCCTTCACTTGTAGTGATTTATCATTCAATGAAGGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

159

Amino Acids

18.45

Weight (kDa)

6.43

Isoelectric Point (pI)

33.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019581)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00530
fragaria_vesca FvH4_3g27991
malus_domestica MD08G1223200.v1.1
prunus_persica Prupe.7G029500_v2.0.a1
pyrus_communis pycom04g07520 pycom12397g00230
rosa_chinensis RchiOBHm_CPg0502081

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 318
AclWI GGATC 3 cut(s) 58, 99, 419
AcsI RAATTY 1 cut(s) 206
AfiI CCNNNNNNNGG 2 cut(s) 294, 295
AflII CTTAAG 1 cut(s) 220
AgsI TTSAA 2 cut(s) 203, 465
AjuI GAANNNNNNNTTGG 2 cut(s) 291, 323
AluBI AGCT 1 cut(s) 239
AluI AGCT 1 cut(s) 239
AlwI GGATC 3 cut(s) 58, 99, 419
ApoI RAATTY 1 cut(s) 206
AsuC2I CCSGG 1 cut(s) 17
BarI GAAGNNNNNNTAC 2 cut(s) 12, 44
BclI TGATCA 2 cut(s) 72, 346
BcnI CCSGG 1 cut(s) 17
BfrI CTTAAG 1 cut(s) 220
Bme1390I CCNGG 1 cut(s) 17
BmrFI CCNGG 1 cut(s) 17
BmsI GCATC 2 cut(s) 51, 69
BpuMI CCSGG 1 cut(s) 17
BsaJI CCNNGG 1 cut(s) 289
BsaWI WCCGGW 1 cut(s) 359
Bsc4I CCNNNNNNNGG 2 cut(s) 294, 295
Bse1I ACTGG 1 cut(s) 380
BseDI CCNNGG 1 cut(s) 289
BseLI CCNNNNNNNGG 2 cut(s) 294, 295
BseNI ACTGG 1 cut(s) 380
BsiSI CCGG 2 cut(s) 17, 360
BslI CCNNNNNNNGG 2 cut(s) 294, 295
Bsp143I GATC 5 cut(s) 63, 72, 91, 346, 411
BspPI GGATC 3 cut(s) 58, 99, 419
BspTI CTTAAG 1 cut(s) 220
BsrI ACTGG 1 cut(s) 380
BssECI CCNNGG 1 cut(s) 289
BssMI GATC 5 cut(s) 63, 72, 91, 346, 411
Bst4CI ACNGT 1 cut(s) 293
BstAFI CTTAAG 1 cut(s) 220
BstC8I GCNNGC 1 cut(s) 98
BstDEI CTNAG 1 cut(s) 146
BstDSI CCRYGG 1 cut(s) 289
BstKTI GATC 5 cut(s) 66, 75, 94, 349, 414
BstMBI GATC 5 cut(s) 63, 72, 91, 346, 411
BstSCI CCNGG 1 cut(s) 15
BstX2I RGATCY 1 cut(s) 411
BstYI RGATCY 1 cut(s) 411
BtgI CCRYGG 1 cut(s) 289
Cac8I GCNNGC 1 cut(s) 98
CviJI RGCY 3 cut(s) 37, 239, 312
CviKI_1 RGCY 3 cut(s) 37, 239, 312
DdeI CTNAG 1 cut(s) 146
DpnI GATC 5 cut(s) 65, 74, 93, 348, 413
DpnII GATC 5 cut(s) 63, 72, 91, 346, 411
DraI TTTAAA 2 cut(s) 403, 426
EcoRI GAATTC 1 cut(s) 206
FaiI YATR 9 cut(s) 102, 128, 164, 214, 216, 268, 272, 342, 356
FbaI TGATCA 2 cut(s) 72, 346
FblI GTMKAC 1 cut(s) 318
HapII CCGG 2 cut(s) 17, 360
HindIII AAGCTT 1 cut(s) 237
HinfI GANTC 1 cut(s) 276
HpaII CCGG 2 cut(s) 17, 360
Hpy166II GTNNAC 1 cut(s) 319
Hpy188III TCNNGA 3 cut(s) 76, 118, 203
Hpy8I GTNNAC 1 cut(s) 319
HpyAV CCTTC 2 cut(s) 450, 463
HpyCH4III ACNGT 1 cut(s) 293
HpyCH4V TGCA 1 cut(s) 82
HpyF3I CTNAG 1 cut(s) 146
Ksp22I TGATCA 2 cut(s) 72, 346
Kzo9I GATC 5 cut(s) 63, 72, 91, 346, 411
LpnPI CCDG 3 cut(s) 30, 373, 393
LweI GCATC 2 cut(s) 51, 69
MalI GATC 5 cut(s) 65, 74, 93, 348, 413
MboI GATC 5 cut(s) 63, 72, 91, 346, 411
MboII GAAGA 1 cut(s) 185
MfeI CAATTG 1 cut(s) 68
MflI RGATCY 1 cut(s) 411
MluCI AATT 5 cut(s) 68, 105, 206, 351, 396
MnlI CCTC 2 cut(s) 48, 82
MseI TTAA 6 cut(s) 5, 189, 221, 257, 402, 425
MspCI CTTAAG 1 cut(s) 220
MspI CCGG 2 cut(s) 17, 360
MspR9I CCNGG 1 cut(s) 17
MunI CAATTG 1 cut(s) 68
NciI CCSGG 1 cut(s) 17
NdeII GATC 5 cut(s) 63, 72, 91, 346, 411
PfeI GAWTC 1 cut(s) 276
PsuI RGATCY 1 cut(s) 411
SaqAI TTAA 6 cut(s) 5, 189, 221, 257, 402, 425
Sau3AI GATC 5 cut(s) 63, 72, 91, 346, 411
ScrFI CCNGG 1 cut(s) 17
SetI ASST 2 cut(s) 169, 241
SfaNI GCATC 2 cut(s) 51, 69
SmiI ATTTAAAT 1 cut(s) 426
SmlI CTYRAG 1 cut(s) 220
SmoI CTYRAG 1 cut(s) 220
Sse9I AATT 5 cut(s) 68, 105, 206, 351, 396
SspI AATATT 1 cut(s) 407
StyD4I CCNGG 1 cut(s) 15
SwaI ATTTAAAT 1 cut(s) 426
TaaI ACNGT 1 cut(s) 293
TaqI TCGA 1 cut(s) 119
TasI AATT 5 cut(s) 68, 105, 206, 351, 396
TfiI GAWTC 1 cut(s) 276
Tru1I TTAA 6 cut(s) 5, 189, 221, 257, 402, 425
Tru9I TTAA 6 cut(s) 5, 189, 221, 257, 402, 425
TspDTI ATGAA 1 cut(s) 186
Vha464I CTTAAG 1 cut(s) 220
XapI RAATTY 1 cut(s) 206
XmiI GTMKAC 1 cut(s) 318
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.