MD08G1223200.v1.1

May be involved in proton extrusion. Indirectly promotes efficient inorganic carbon uptake

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
Physical Location & Seq
Forward (+)
28672411 .. 28672623
213 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1223200.v1.1.491

Sequence Viewer

Length: 213 bp
ATGTTGATGCCCGAGCCACTCTTATTTGGTTGGGAATTAATGTTTGACTTTGTCTATAAAGATTTTGGATTTGCTCATAATGATCAAATTATATCCGGTCTTATTTCTACTTTTTCAGTCATATTAGATACAATTTTTAAATACTGGATCTTTCGTTATTTAAATCATGTATCTCCTTCACTTGTAGTAATTTATCATTCAATGAATGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

8.34

Weight (kDa)

5.04

Isoelectric Point (pI)

32.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CemA PF03040 10 - 70 8.9e-26 CemA family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019581)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00530
fragaria_vesca FvH4_3g27991
malus_domestica MD08G1223200.v1.1
prunus_persica Prupe.7G029500_v2.0.a1
pyrus_communis pycom04g07520 pycom12397g00230
rosa_chinensis RchiOBHm_CPg0502081

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 155
AgsI TTSAA 1 cut(s) 201
AlwI GGATC 1 cut(s) 155
Ama87I CYCGRG 1 cut(s) 11
AseI ATTAAT 1 cut(s) 38
AvaI CYCGRG 1 cut(s) 11
BclI TGATCA 1 cut(s) 82
BmeT110I CYCGRG 1 cut(s) 11
BsaWI WCCGGW 1 cut(s) 95
Bse1I ACTGG 1 cut(s) 149
BseNI ACTGG 1 cut(s) 149
BsiHKCI CYCGRG 1 cut(s) 11
BsiSI CCGG 1 cut(s) 96
BsoBI CYCGRG 1 cut(s) 11
Bsp143I GATC 2 cut(s) 82, 147
BspPI GGATC 1 cut(s) 155
BsrI ACTGG 1 cut(s) 149
BssMI GATC 2 cut(s) 82, 147
BstKTI GATC 2 cut(s) 85, 150
BstMBI GATC 2 cut(s) 82, 147
BstX2I RGATCY 1 cut(s) 147
BstYI RGATCY 1 cut(s) 147
CviAII CATG 1 cut(s) 167
CviJI RGCY 1 cut(s) 16
CviKI_1 RGCY 1 cut(s) 16
DpnI GATC 2 cut(s) 84, 149
DpnII GATC 2 cut(s) 82, 147
DraI TTTAAA 2 cut(s) 139, 162
Eco88I CYCGRG 1 cut(s) 11
FaeI CATG 1 cut(s) 170
FaiI YATR 5 cut(s) 57, 78, 92, 122, 168
FatI CATG 1 cut(s) 166
FbaI TGATCA 1 cut(s) 82
HapII CCGG 1 cut(s) 96
Hin1II CATG 1 cut(s) 170
HpaII CCGG 1 cut(s) 96
HpyAV CCTTC 1 cut(s) 186
Hsp92II CATG 1 cut(s) 170
Ksp22I TGATCA 1 cut(s) 82
Kzo9I GATC 2 cut(s) 82, 147
LpnPI CCDG 2 cut(s) 109, 130
MalI GATC 2 cut(s) 84, 149
MboI GATC 2 cut(s) 82, 147
MflI RGATCY 1 cut(s) 147
MluCI AATT 4 cut(s) 35, 87, 132, 189
MseI TTAA 3 cut(s) 38, 138, 161
MspI CCGG 1 cut(s) 96
NdeII GATC 2 cut(s) 82, 147
NlaIII CATG 1 cut(s) 170
PflFI GACNNNGTC 1 cut(s) 50
PshBI ATTAAT 1 cut(s) 38
PsuI RGATCY 1 cut(s) 147
PsyI GACNNNGTC 1 cut(s) 50
SaqAI TTAA 3 cut(s) 38, 138, 161
Sau3AI GATC 2 cut(s) 82, 147
SgeI CNNG 6 cut(s) 23, 25, 108, 157, 179, 194
SmiI ATTTAAAT 1 cut(s) 162
Sse9I AATT 4 cut(s) 35, 87, 132, 189
SwaI ATTTAAAT 1 cut(s) 162
TasI AATT 4 cut(s) 35, 87, 132, 189
Tru1I TTAA 3 cut(s) 38, 138, 161
Tru9I TTAA 3 cut(s) 38, 138, 161
Tth111I GACNNNGTC 1 cut(s) 50
VspI ATTAAT 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.