RCHIOBHM_CPG0502081

CemA family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
Pt
OG0019581
Physical Location & Seq
Reverse (-)
50181 .. 51234
1054 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ15696

Sequence Viewer

Length: 690 bp
ATGGCAAAAAAGAAAGTATTCATTTCCCTTCTATATCTTGCATTTATAGTATTTTTGCCTTGGTGGATCTCTCTCTCATTTAAAAAAAGTCTGGAATCTTGGATTACCAATTGGTGGAATATTAGGCAATCCGAAATTTTTTTGAATGATATTCAAGAAAAGAGTATTCTAAAAAAATTCATAGACTTGGAGGAACTCCTTCGTTTGGAGGAAATGATAAAGGAATACCCAGAAACGCATTTACAAAAGCTTCGCGTCGAAATCTACAAAGAAACGACCCAATTGATCAAGATGCACAATGAGGATCGTATCCATACAATTTTACACTTCTCGACAAATATAATCTGTTTCGTTATTCTAAGTGGTTATTCTATTCTAGGTAATGAAGAACTTGTTATTCTTAACTCTTGGATTCAAGAATTCCTATATAACTTAAGCGACACAATAAAAGCTTTTTCTATTCTTTTATTAACTGATTTATGTATAGGATTCCATTCGCCCCACGGTTGGGAATTAATGATTGGCTCTGTCTACAAAGATTTTGGATTTGCTCATAATGATCAAATTATATCCGGTCTTGTTTCTACTTTTCCAGTCATTTTAGATACAATTTTTAAATATTGGATCTTTCGTTATTTAAATCGTGTATCTCCTTCACTTGTAGTGATTTATCATTCAATGAATGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CemA

Protein Analysis

229

Amino Acids

27.19

Weight (kDa)

6.06

Isoelectric Point (pI)

41.87

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CemA PF03040 3 - 229 4.2e-82 CemA family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019581)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00530
fragaria_vesca FvH4_3g27991
malus_domestica MD08G1223200.v1.1
prunus_persica Prupe.7G029500_v2.0.a1
pyrus_communis pycom04g07520 pycom12397g00230
rosa_chinensis RchiOBHm_CPg0502081

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 114
AccI GTMKAC 1 cut(s) 531
AccII CGCG 1 cut(s) 255
AclWI GGATC 3 cut(s) 74, 312, 632
AcsI RAATTY 3 cut(s) 135, 176, 419
AfiI CCNNNNNNNGG 4 cut(s) 114, 205, 507, 508
AflII CTTAAG 1 cut(s) 433
AgsI TTSAA 4 cut(s) 145, 155, 416, 678
AjuI GAANNNNNNNTTGG 2 cut(s) 504, 536
AluBI AGCT 2 cut(s) 250, 452
AluI AGCT 2 cut(s) 250, 452
AlwI GGATC 3 cut(s) 74, 312, 632
ApoI RAATTY 3 cut(s) 135, 176, 419
AseI ATTAAT 1 cut(s) 515
Asp700I GAANNNNTTC 2 cut(s) 17, 198
BciVI GTATCC 1 cut(s) 320
BclI TGATCA 2 cut(s) 285, 559
BfaI CTAG 1 cut(s) 377
BfrI CTTAAG 1 cut(s) 433
BfuI GTATCC 1 cut(s) 320
BmsI GCATC 1 cut(s) 282
BsaJI CCNNGG 2 cut(s) 59, 502
BsaWI WCCGGW 1 cut(s) 572
Bsc4I CCNNNNNNNGG 4 cut(s) 114, 205, 507, 508
Bse1I ACTGG 1 cut(s) 593
BseDI CCNNGG 2 cut(s) 59, 502
BseLI CCNNNNNNNGG 4 cut(s) 114, 205, 507, 508
BseNI ACTGG 1 cut(s) 593
Bsh1236I CGCG 1 cut(s) 255
BsiSI CCGG 1 cut(s) 573
BslI CCNNNNNNNGG 4 cut(s) 114, 205, 507, 508
Bsp143I GATC 5 cut(s) 66, 285, 304, 559, 624
BspFNI CGCG 1 cut(s) 255
BspPI GGATC 3 cut(s) 74, 312, 632
BspTI CTTAAG 1 cut(s) 433
BsrI ACTGG 1 cut(s) 593
BssECI CCNNGG 2 cut(s) 59, 502
BssMI GATC 5 cut(s) 66, 285, 304, 559, 624
BssT1I CCWWGG 1 cut(s) 59
Bst4CI ACNGT 1 cut(s) 506
BstAFI CTTAAG 1 cut(s) 433
BstDEI CTNAG 1 cut(s) 359
BstDSI CCRYGG 1 cut(s) 502
BstFNI CGCG 1 cut(s) 255
BstKTI GATC 5 cut(s) 69, 288, 307, 562, 627
BstMBI GATC 5 cut(s) 66, 285, 304, 559, 624
BstUI CGCG 1 cut(s) 255
BstX2I RGATCY 2 cut(s) 66, 624
BstYI RGATCY 2 cut(s) 66, 624
BsuI GTATCC 1 cut(s) 320
BtgI CCRYGG 1 cut(s) 502
CseI GACGC 1 cut(s) 244
CviJI RGCY 3 cut(s) 250, 452, 525
CviKI_1 RGCY 3 cut(s) 250, 452, 525
DdeI CTNAG 1 cut(s) 359
DpnI GATC 5 cut(s) 68, 287, 306, 561, 626
DpnII GATC 5 cut(s) 66, 285, 304, 559, 624
DraI TTTAAA 3 cut(s) 82, 616, 639
Eco130I CCWWGG 1 cut(s) 59
EcoRI GAATTC 1 cut(s) 419
EcoT14I CCWWGG 1 cut(s) 59
ErhI CCWWGG 1 cut(s) 59
FbaI TGATCA 2 cut(s) 285, 559
FblI GTMKAC 1 cut(s) 531
FspBI CTAG 1 cut(s) 377
HapII CCGG 1 cut(s) 573
HgaI GACGC 1 cut(s) 244
HindIII AAGCTT 2 cut(s) 248, 450
HinfI GANTC 3 cut(s) 95, 412, 489
HpaII CCGG 1 cut(s) 573
Hpy166II GTNNAC 1 cut(s) 532
Hpy188I TCNGA 1 cut(s) 133
Hpy188III TCNNGA 5 cut(s) 92, 155, 289, 331, 416
Hpy8I GTNNAC 1 cut(s) 532
Hpy99I CGWCG 1 cut(s) 260
HpyAV CCTTC 3 cut(s) 38, 209, 663
HpyCH4III ACNGT 1 cut(s) 506
HpyCH4V TGCA 2 cut(s) 41, 295
HpyF3I CTNAG 1 cut(s) 359
Ksp22I TGATCA 2 cut(s) 285, 559
Kzo9I GATC 5 cut(s) 66, 285, 304, 559, 624
LpnPI CCDG 4 cut(s) 77, 243, 586, 606
LweI GCATC 1 cut(s) 282
MaeI CTAG 1 cut(s) 377
MalI GATC 5 cut(s) 68, 287, 306, 561, 626
MboI GATC 5 cut(s) 66, 285, 304, 559, 624
MboII GAAGA 1 cut(s) 398
MfeI CAATTG 2 cut(s) 109, 281
MflI RGATCY 2 cut(s) 66, 624
MluCI AATT 9 cut(s) 109, 135, 176, 281, 318, 419, 512, 564, 609
MnlI CCTC 3 cut(s) 184, 202, 295
MroXI GAANNNNTTC 2 cut(s) 17, 198
MseI TTAA 7 cut(s) 81, 402, 434, 470, 515, 615, 638
MspCI CTTAAG 1 cut(s) 433
MspI CCGG 1 cut(s) 573
MunI CAATTG 2 cut(s) 109, 281
MvnI CGCG 1 cut(s) 255
NdeII GATC 5 cut(s) 66, 285, 304, 559, 624
PdmI GAANNNNTTC 2 cut(s) 17, 198
PfeI GAWTC 3 cut(s) 95, 412, 489
PflMI CCANNNNNTGG 1 cut(s) 114
PshBI ATTAAT 1 cut(s) 515
PsuI RGATCY 2 cut(s) 66, 624
SaqAI TTAA 7 cut(s) 81, 402, 434, 470, 515, 615, 638
Sau3AI GATC 5 cut(s) 66, 285, 304, 559, 624
SetI ASST 3 cut(s) 252, 382, 454
SfaNI GCATC 1 cut(s) 282
SmiI ATTTAAAT 1 cut(s) 639
SmlI CTYRAG 1 cut(s) 433
SmoI CTYRAG 1 cut(s) 433
Sse9I AATT 9 cut(s) 109, 135, 176, 281, 318, 419, 512, 564, 609
SspI AATATT 2 cut(s) 121, 620
SspMI CTAG 1 cut(s) 377
StyI CCWWGG 1 cut(s) 59
SwaI ATTTAAAT 1 cut(s) 639
TaaI ACNGT 1 cut(s) 506
TaqI TCGA 2 cut(s) 258, 332
TasI AATT 9 cut(s) 109, 135, 176, 281, 318, 419, 512, 564, 609
TfiI GAWTC 3 cut(s) 95, 412, 489
Tru1I TTAA 7 cut(s) 81, 402, 434, 470, 515, 615, 638
Tru9I TTAA 7 cut(s) 81, 402, 434, 470, 515, 615, 638
TspDTI ATGAA 3 cut(s) 10, 169, 399
Van91I CCANNNNNTGG 1 cut(s) 114
Vha464I CTTAAG 1 cut(s) 433
VspI ATTAAT 1 cut(s) 515
XapI RAATTY 3 cut(s) 135, 176, 419
XmiI GTMKAC 1 cut(s) 531
XmnI GAANNNNTTC 2 cut(s) 17, 198
XspI CTAG 1 cut(s) 377
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.