FvH4_3g16231

No apical meristem-associated C-terminal domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
OG0019548
Physical Location & Seq
Reverse (-)
10238777 .. 10240265
1489 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g16231.t1

Sequence Viewer

Length: 432 bp
ATGACGCCTGAATGCGAACGACAGCGATGTCTTGTCGACGATGCTCAGATCCATCCCGGTTCTTTAGGAATTCAACTTGATGTGAACAAATTTTGTGGCATTTATGTTGAAGTTGAAAGGAAAAGAGCAAGTGGTACAACTGAACAAGATAGGATGTTGGAAGCCAAACAAAAGTTTAGGAAATTGATAAAAAGAAACTTTGCATATGAGCATTGTTGGAATCTGTTGAAGTTCCACCCAAAATGGAACTTGGAACTCTCTAGGAAAAAACCAAAGACGATTCCTGCAACTCCATCTCTTGACACTCCATCTGCTAGCTCAGATACAATCGATTTAGCTGATGGTGATGGTCAAGGCAATAAGGCTCAAGGCTTGGTGAGGCCTATAGGAAAAAAAGGTTGCGAAGACCTTGGCAAAAAATGCAAAAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM-associated

Protein Analysis

144

Amino Acids

16.1

Weight (kDa)

9.17

Isoelectric Point (pI)

31.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM-associated PF14303 65 - 132 6.5e-10 No apical meristem-associated C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019548)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g16231 FvH4_3g26413 FvH4_5g21960
rosa_laevigata RLG00000024698
rosa_roxburghii Rroxscaffold_2G00090990
rosa_samantha Rh5AG464300 Rh5BG276700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 27
AccI GTMKAC 1 cut(s) 36
AclWI GGATC 1 cut(s) 43
AcsI RAATTY 2 cut(s) 69, 89
AcyI GRCGYC 1 cut(s) 5
AfaI GTAC 1 cut(s) 136
AgsI TTSAA 4 cut(s) 74, 110, 116, 229
AluBI AGCT 3 cut(s) 318, 338, 429
AluI AGCT 3 cut(s) 318, 338, 429
AlwI GGATC 1 cut(s) 43
AoxI GGCC 1 cut(s) 380
ApoI RAATTY 2 cut(s) 69, 89
AsuC2I CCSGG 1 cut(s) 57
AsuHPI GGTGA 2 cut(s) 356, 388
AsuNHI GCTAGC 1 cut(s) 314
BbsI GAAGAC 1 cut(s) 411
BccI CCATC 5 cut(s) 60, 301, 316, 335, 341
BcnI CCSGG 1 cut(s) 57
BfaI CTAG 2 cut(s) 261, 315
BfmI CTRYAG 1 cut(s) 384
Bme1390I CCNGG 1 cut(s) 57
BmrFI CCNGG 1 cut(s) 57
BmsI GCATC 1 cut(s) 31
BmtI GCTAGC 1 cut(s) 318
BpiI GAAGAC 1 cut(s) 411
BpuEI CTTGAG 1 cut(s) 351
BpuMI CCSGG 1 cut(s) 57
Bsa29I ATCGAT 1 cut(s) 330
BsaHI GRCGYC 1 cut(s) 5
BsaJI CCNNGG 1 cut(s) 409
BseCI ATCGAT 1 cut(s) 330
BseDI CCNNGG 1 cut(s) 409
BseGI GGATG 2 cut(s) 52, 159
BseMII CTCAG 2 cut(s) 59, 333
BshFI GGCC 1 cut(s) 382
BshVI ATCGAT 1 cut(s) 330
BsiSI CCGG 1 cut(s) 57
BsmI GAATGC 1 cut(s) 17
BsnI GGCC 1 cut(s) 382
Bsp143I GATC 1 cut(s) 48
BspANI GGCC 1 cut(s) 382
BspCNI CTCAG 2 cut(s) 58, 332
BspDI ATCGAT 1 cut(s) 330
BspOI GCTAGC 1 cut(s) 318
BspPI GGATC 1 cut(s) 43
BssECI CCNNGG 1 cut(s) 409
BssMI GATC 1 cut(s) 48
BssNI GRCGYC 1 cut(s) 5
BssT1I CCWWGG 1 cut(s) 409
BstACI GRCGYC 1 cut(s) 5
BstAPI GCANNNNNTGC 1 cut(s) 420
BstC8I GCNNGC 1 cut(s) 316
BstDEI CTNAG 2 cut(s) 45, 319
BstF5I GGATG 2 cut(s) 52, 159
BstKTI GATC 1 cut(s) 51
BstMBI GATC 1 cut(s) 48
BstMWI GCNNNNNNNGC 1 cut(s) 420
BstSCI CCNGG 1 cut(s) 55
BstSFI CTRYAG 1 cut(s) 384
BstV2I GAAGAC 1 cut(s) 411
BstX2I RGATCY 1 cut(s) 48
BstYI RGATCY 1 cut(s) 48
Bsu15I ATCGAT 1 cut(s) 330
BsuRI GGCC 1 cut(s) 382
BsuTUI ATCGAT 1 cut(s) 330
BtgZI GCGATG 1 cut(s) 40
BtsCI GGATG 2 cut(s) 52, 159
Cac8I GCNNGC 1 cut(s) 316
ClaI ATCGAT 1 cut(s) 330
CseI GACGC 1 cut(s) 13
Csp6I GTAC 1 cut(s) 135
CspCI CAANNNNNGTGG 2 cut(s) 76, 111
CviJI RGCY 7 cut(s) 164, 318, 338, 365, 372, 382, 429
CviKI_1 RGCY 7 cut(s) 164, 318, 338, 365, 372, 382, 429
CviQI GTAC 1 cut(s) 135
DdeI CTNAG 2 cut(s) 45, 319
DpnI GATC 1 cut(s) 50
DpnII GATC 1 cut(s) 48
DrdI GACNNNNNNGTC 1 cut(s) 27
DseDI GACNNNNNNGTC 1 cut(s) 27
Eco130I CCWWGG 1 cut(s) 409
Eco147I AGGCCT 1 cut(s) 382
EcoRI GAATTC 1 cut(s) 69
EcoT14I CCWWGG 1 cut(s) 409
ErhI CCWWGG 1 cut(s) 409
FaiI YATR 4 cut(s) 105, 205, 207, 386
FauNDI CATATG 1 cut(s) 205
FblI GTMKAC 1 cut(s) 36
FokI GGATG 2 cut(s) 39, 166
FspBI CTAG 2 cut(s) 261, 315
HaeIII GGCC 1 cut(s) 382
HapII CCGG 1 cut(s) 57
HgaI GACGC 1 cut(s) 13
Hin1I GRCGYC 1 cut(s) 5
HincII GTYRAC 1 cut(s) 37
HindII GTYRAC 1 cut(s) 37
HinfI GANTC 2 cut(s) 220, 280
HpaII CCGG 1 cut(s) 57
HphI GGTGA 2 cut(s) 356, 388
Hpy166II GTNNAC 2 cut(s) 37, 85
Hpy188I TCNGA 2 cut(s) 48, 322
Hpy188III TCNNGA 1 cut(s) 299
Hpy8I GTNNAC 2 cut(s) 37, 85
Hpy99I CGWCG 1 cut(s) 41
HpyCH4V TGCA 3 cut(s) 203, 287, 423
HpyF10VI GCNNNNNNNGC 1 cut(s) 420
HpyF3I CTNAG 2 cut(s) 45, 319
Hsp92I GRCGYC 1 cut(s) 5
Kzo9I GATC 1 cut(s) 48
LpnPI CCDG 3 cut(s) 21, 70, 297
LweI GCATC 1 cut(s) 31
MaeI CTAG 2 cut(s) 261, 315
MalI GATC 1 cut(s) 50
MboI GATC 1 cut(s) 48
MboII GAAGA 1 cut(s) 416
MflI RGATCY 1 cut(s) 48
MluCI AATT 3 cut(s) 69, 89, 182
MmeI TCCRAC 2 cut(s) 138, 197
MnlI CCTC 1 cut(s) 372
MspI CCGG 1 cut(s) 57
MspR9I CCNGG 1 cut(s) 57
Mva1269I GAATGC 1 cut(s) 17
MwoI GCNNNNNNNGC 1 cut(s) 420
NciI CCSGG 1 cut(s) 57
NdeI CATATG 1 cut(s) 205
NdeII GATC 1 cut(s) 48
NheI GCTAGC 1 cut(s) 314
PceI AGGCCT 1 cut(s) 382
PctI GAATGC 1 cut(s) 17
PfeI GAWTC 2 cut(s) 220, 280
PsuI RGATCY 1 cut(s) 48
RsaI GTAC 1 cut(s) 136
RsaNI GTAC 1 cut(s) 135
SalI GTCGAC 1 cut(s) 35
Sau3AI GATC 1 cut(s) 48
ScrFI CCNGG 1 cut(s) 57
SetI ASST 5 cut(s) 320, 340, 400, 411, 431
SfaNI GCATC 1 cut(s) 31
SfcI CTRYAG 1 cut(s) 384
SmlI CTYRAG 1 cut(s) 366
SmoI CTYRAG 1 cut(s) 366
Sse9I AATT 3 cut(s) 69, 89, 182
SseBI AGGCCT 1 cut(s) 382
SspMI CTAG 2 cut(s) 261, 315
StuI AGGCCT 1 cut(s) 382
StyD4I CCNGG 1 cut(s) 55
StyI CCWWGG 1 cut(s) 409
TaqI TCGA 2 cut(s) 36, 330
TasI AATT 3 cut(s) 69, 89, 182
TfiI GAWTC 2 cut(s) 220, 280
XapI RAATTY 2 cut(s) 69, 89
XmiI GTMKAC 1 cut(s) 36
XspI CTAG 2 cut(s) 261, 315
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.