Rroxscaffold_2G00090990

No apical meristem-associated C-terminal domain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
12648393 .. 12648810
418 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00090990.1

Sequence Viewer

Length: 240 bp
ATGCAACGGTTCCTCGCTACTTCGTCTCCTATCACTCCATCTGCTAGCCCGGATACAATAGATTTAGCTGATGGCAATGTTGAAGAACAAGAGAACATTAAGCCGAGGAAACAAGAACTTGAAATTCAAGTTCGAAAAGAGGATAATGCAATAATGGCAATTGATACCTCTACAATGGAACCAATGCGGTCGAATATTTTAGAGGACTTCAACAGAAATCATAGCAAAAAGAGCTACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

9.02

Weight (kDa)

4.86

Isoelectric Point (pI)

57.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019548)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g16231 FvH4_3g26413 FvH4_5g21960
rosa_laevigata RLG00000024698
rosa_roxburghii Rroxscaffold_2G00090990
rosa_samantha Rh5AG464300 Rh5BG276700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 187
AcsI RAATTY 1 cut(s) 123
AgsI TTSAA 4 cut(s) 83, 122, 128, 211
AluBI AGCT 2 cut(s) 68, 234
AluI AGCT 2 cut(s) 68, 234
Alw26I GTCTC 1 cut(s) 30
ApoI RAATTY 1 cut(s) 123
AsuC2I CCSGG 1 cut(s) 50
AsuII TTCGAA 1 cut(s) 133
AsuNHI GCTAGC 1 cut(s) 44
BccI CCATC 2 cut(s) 46, 65
BciVI GTATCC 1 cut(s) 46
BcnI CCSGG 1 cut(s) 50
BcoDI GTCTC 1 cut(s) 30
BfaI CTAG 1 cut(s) 45
BfuI GTATCC 1 cut(s) 46
Bme1390I CCNGG 1 cut(s) 50
BmiI GGNNCC 2 cut(s) 11, 180
BmrFI CCNGG 1 cut(s) 50
BmtI GCTAGC 1 cut(s) 48
Bpu14I TTCGAA 1 cut(s) 133
BpuMI CCSGG 1 cut(s) 50
BsaJI CCNNGG 1 cut(s) 104
BsaXI ACNNNNNCTCC 2 cut(s) 10, 40
Bse3DI GCAATG 1 cut(s) 82
BseDI CCNNGG 1 cut(s) 104
BseMI GCAATG 1 cut(s) 82
Bsh1285I CGRYCG 1 cut(s) 191
BsiEI CGRYCG 1 cut(s) 191
BsiSI CCGG 1 cut(s) 50
BsmAI GTCTC 1 cut(s) 30
BsmBI CGTCTC 1 cut(s) 30
Bsp119I TTCGAA 1 cut(s) 133
BspACI CCGC 1 cut(s) 187
BspLI GGNNCC 2 cut(s) 11, 180
BspOI GCTAGC 1 cut(s) 48
BspT104I TTCGAA 1 cut(s) 133
BsrDI GCAATG 1 cut(s) 82
BssECI CCNNGG 1 cut(s) 104
Bst4CI ACNGT 1 cut(s) 9
BstBI TTCGAA 1 cut(s) 133
BstC8I GCNNGC 1 cut(s) 46
BstMAI GTCTC 1 cut(s) 30
BstMCI CGRYCG 1 cut(s) 191
BstMWI GCNNNNNNNGC 2 cut(s) 155, 231
BstSCI CCNGG 1 cut(s) 48
BsuI GTATCC 1 cut(s) 46
Cac8I GCNNGC 1 cut(s) 46
CviJI RGCY 4 cut(s) 48, 68, 103, 234
CviKI_1 RGCY 4 cut(s) 48, 68, 103, 234
Esp3I CGTCTC 1 cut(s) 30
FaiI YATR 1 cut(s) 222
FspBI CTAG 1 cut(s) 45
HapII CCGG 1 cut(s) 50
HpaII CCGG 1 cut(s) 50
HpyCH4III ACNGT 1 cut(s) 9
HpyCH4V TGCA 2 cut(s) 4, 149
HpyF10VI GCNNNNNNNGC 2 cut(s) 155, 231
LpnPI CCDG 1 cut(s) 63
MaeI CTAG 1 cut(s) 45
MboII GAAGA 1 cut(s) 95
MfeI CAATTG 1 cut(s) 159
MluCI AATT 2 cut(s) 123, 159
MnlI CCTC 5 cut(s) 23, 99, 133, 178, 196
MseI TTAA 1 cut(s) 99
MspI CCGG 1 cut(s) 50
MspR9I CCNGG 1 cut(s) 50
MunI CAATTG 1 cut(s) 159
MwoI GCNNNNNNNGC 2 cut(s) 155, 231
NciI CCSGG 1 cut(s) 50
NheI GCTAGC 1 cut(s) 44
NlaIV GGNNCC 2 cut(s) 11, 180
NmeAIII GCCGAG 1 cut(s) 129
NspV TTCGAA 1 cut(s) 133
PspN4I GGNNCC 2 cut(s) 11, 180
SaqAI TTAA 1 cut(s) 99
ScrFI CCNGG 1 cut(s) 50
SetI ASST 3 cut(s) 70, 170, 236
SfuI TTCGAA 1 cut(s) 133
SgeI CNNG 9 cut(s) 26, 57, 61, 62, 101, 117, 125, 131, 140
Sse9I AATT 2 cut(s) 123, 159
SsiI CCGC 1 cut(s) 187
SspI AATATT 1 cut(s) 196
SspMI CTAG 1 cut(s) 45
StyD4I CCNGG 1 cut(s) 48
TaaI ACNGT 1 cut(s) 9
TaqI TCGA 2 cut(s) 133, 191
TasI AATT 2 cut(s) 123, 159
Tru1I TTAA 1 cut(s) 99
Tru9I TTAA 1 cut(s) 99
XapI RAATTY 1 cut(s) 123
XspI CTAG 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.