RLG00000024698

No apical meristem-associated C-terminal domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
OG0019548
Physical Location & Seq
Reverse (-)
38341081 .. 38341823
743 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000024698

Sequence Viewer

Length: 579 bp
ATGCATCGCTGGTCTGGAATTCAACTGGATGTTAACAAATTTTGTGGCTATTATGCTGAAATTACAAGAGCAAGTGGTACAACTGAACAAGATAGGTTCCACCCAAAATGGAACTTGGAACTCTCTAGGAAAAAACCAAAGAAAATTCATGCTACGATTCCTGCTACTTCGTCTCCTATCACTCCATCTGCTAGTCCAGATACAATAGATTTAGTTGATGGCGATGTTGAAGGTAATGAGTCTCCATGCTTGGAGAGGCGTATAGGCAAAAAGGCTGCCAAGACCTTGGTAAGGAAGGCAAAAGCTAAAGGGAAAGTGGAAGCAGCCCAATCTGAATTAGGAGACTATTATGGTCTGAAAGTTGAACATTCTCATAAGGATGATGAGCAATTTCAACTGATGTATGATGCAGAACAAGAGAACTTTAAGCTGAGGAAACAAGAACTTGAAATTCAAGTTCGAAAAGAGGATAATGCAATAATGGCAATTGATACTTCTACAATGGAACCAATGCTAGCAGAATATTTTAGAGGACTTCAACAAGAAATCATAGCAAAAAGAGCTGCTAATGGAAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM-associated

Protein Analysis

193

Amino Acids

21.77

Weight (kDa)

6.97

Isoelectric Point (pI)

49.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM-associated PF14303 32 - 183 2e-13 No apical meristem-associated C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019548)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g16231 FvH4_3g26413 FvH4_5g21960
rosa_laevigata RLG00000024698
rosa_roxburghii Rroxscaffold_2G00090990
rosa_samantha Rh5AG464300 Rh5BG276700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 4 cut(s) 18, 38, 144, 450
AfaI GTAC 1 cut(s) 79
AfiI CCNNNNNNNGG 1 cut(s) 291
AgsI TTSAA 7 cut(s) 23, 230, 365, 395, 449, 455, 539
AluBI AGCT 3 cut(s) 305, 430, 563
AluI AGCT 3 cut(s) 305, 430, 563
Alw26I GTCTC 3 cut(s) 177, 246, 336
ApeKI GCWGC 3 cut(s) 275, 323, 563
ApoI RAATTY 4 cut(s) 18, 38, 144, 450
AsuII TTCGAA 1 cut(s) 460
AsuNHI GCTAGC 1 cut(s) 514
BbvCI CCTCAGC 1 cut(s) 431
BbvI GCAGC 3 cut(s) 262, 335, 550
BccI CCATC 2 cut(s) 193, 212
BcoDI GTCTC 3 cut(s) 177, 246, 336
BfaI CTAG 4 cut(s) 126, 192, 515, 577
BisI GCNGC 3 cut(s) 276, 324, 564
BlsI GCNGC 3 cut(s) 277, 325, 565
BmiI GGNNCC 2 cut(s) 98, 507
BmsI GCATC 2 cut(s) 13, 397
BmtI GCTAGC 1 cut(s) 518
Bpu10I CCTNAGC 1 cut(s) 431
Bpu14I TTCGAA 1 cut(s) 460
BsaJI CCNNGG 1 cut(s) 285
BsaXI ACNNNNNCTCC 2 cut(s) 157, 187
Bsc4I CCNNNNNNNGG 1 cut(s) 291
Bse1I ACTGG 1 cut(s) 30
BseDI CCNNGG 1 cut(s) 285
BseGI GGATG 2 cut(s) 34, 385
BseLI CCNNNNNNNGG 1 cut(s) 291
BseMII CTCAG 1 cut(s) 422
BseNI ACTGG 1 cut(s) 30
BseXI GCAGC 3 cut(s) 262, 335, 550
BslI CCNNNNNNNGG 1 cut(s) 291
BsmAI GTCTC 3 cut(s) 177, 246, 336
BsmBI CGTCTC 1 cut(s) 177
Bsp119I TTCGAA 1 cut(s) 460
BspCNI CTCAG 1 cut(s) 423
BspLI GGNNCC 2 cut(s) 98, 507
BspOI GCTAGC 1 cut(s) 518
BspT104I TTCGAA 1 cut(s) 460
BsrI ACTGG 1 cut(s) 30
BssECI CCNNGG 1 cut(s) 285
BssT1I CCWWGG 1 cut(s) 285
BstBI TTCGAA 1 cut(s) 460
BstC8I GCNNGC 1 cut(s) 516
BstDEI CTNAG 1 cut(s) 431
BstENI CCTNNNNNAGG 1 cut(s) 289
BstF5I GGATG 2 cut(s) 34, 385
BstMAI GTCTC 3 cut(s) 177, 246, 336
BstMWI GCNNNNNNNGC 2 cut(s) 482, 560
BstV1I GCAGC 3 cut(s) 262, 335, 550
BstXI CCANNNNNNTGG 1 cut(s) 286
BtgZI GCGATG 1 cut(s) 237
BtsCI GGATG 2 cut(s) 34, 385
Cac8I GCNNGC 1 cut(s) 516
Csp6I GTAC 1 cut(s) 78
CspCI CAANNNNNGTGG 2 cut(s) 25, 60
CviAII CATG 2 cut(s) 149, 246
CviJI RGCY 6 cut(s) 48, 275, 305, 326, 430, 563
CviKI_1 RGCY 6 cut(s) 48, 275, 305, 326, 430, 563
CviQI GTAC 1 cut(s) 78
DdeI CTNAG 1 cut(s) 431
Eco130I CCWWGG 1 cut(s) 285
EcoNI CCTNNNNNAGG 1 cut(s) 289
EcoRI GAATTC 1 cut(s) 18
EcoT14I CCWWGG 1 cut(s) 285
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 285
Esp3I CGTCTC 1 cut(s) 177
FaeI CATG 2 cut(s) 152, 249
FaiI YATR 8 cut(s) 54, 150, 247, 263, 351, 375, 405, 551
FatI CATG 2 cut(s) 148, 245
Fnu4HI GCNGC 3 cut(s) 276, 324, 564
FokI GGATG 2 cut(s) 41, 392
Fsp4HI GCNGC 3 cut(s) 276, 324, 564
FspBI CTAG 4 cut(s) 126, 192, 515, 577
GluI GCNGC 3 cut(s) 276, 324, 564
Hin1II CATG 2 cut(s) 152, 249
HincII GTYRAC 1 cut(s) 34
HindII GTYRAC 1 cut(s) 34
HinfI GANTC 2 cut(s) 157, 239
HpaI GTTAAC 1 cut(s) 34
Hpy166II GTNNAC 1 cut(s) 34
Hpy188I TCNGA 2 cut(s) 334, 357
Hpy188III TCNNGA 2 cut(s) 15, 197
Hpy8I GTNNAC 1 cut(s) 34
HpyAV CCTTC 2 cut(s) 224, 289
HpyCH4V TGCA 3 cut(s) 4, 410, 476
HpyF10VI GCNNNNNNNGC 2 cut(s) 482, 560
HpyF3I CTNAG 1 cut(s) 431
Hsp92II CATG 2 cut(s) 152, 249
KspAI GTTAAC 1 cut(s) 34
LpnPI CCDG 3 cut(s) 11, 174, 210
Lsp1109I GCAGC 3 cut(s) 262, 335, 550
LweI GCATC 2 cut(s) 13, 397
MaeI CTAG 4 cut(s) 126, 192, 515, 577
MfeI CAATTG 1 cut(s) 486
MluCI AATT 8 cut(s) 18, 38, 60, 144, 335, 389, 450, 486
MlyI GAGTC 1 cut(s) 248
MnlI CCTC 4 cut(s) 249, 426, 460, 524
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 2 cut(s) 33, 426
MslI CAYNNNNRTG 1 cut(s) 378
MunI CAATTG 1 cut(s) 486
MwoI GCNNNNNNNGC 2 cut(s) 482, 560
NheI GCTAGC 1 cut(s) 514
NlaIII CATG 2 cut(s) 152, 249
NlaIV GGNNCC 2 cut(s) 98, 507
NsiI ATGCAT 1 cut(s) 6
NspV TTCGAA 1 cut(s) 460
PfeI GAWTC 1 cut(s) 157
PkrI GCNGC 3 cut(s) 277, 325, 565
PleI GAGTC 1 cut(s) 247
PpsI GAGTC 1 cut(s) 247
PspN4I GGNNCC 2 cut(s) 98, 507
RsaI GTAC 1 cut(s) 79
RsaNI GTAC 1 cut(s) 78
RseI CAYNNNNRTG 1 cut(s) 378
SaqAI TTAA 2 cut(s) 33, 426
SatI GCNGC 3 cut(s) 276, 324, 564
SchI GAGTC 1 cut(s) 248
SetI ASST 6 cut(s) 98, 235, 287, 307, 432, 565
SfaNI GCATC 2 cut(s) 13, 397
SfuI TTCGAA 1 cut(s) 460
SmiMI CAYNNNNRTG 1 cut(s) 378
Sse9I AATT 8 cut(s) 18, 38, 60, 144, 335, 389, 450, 486
SspI AATATT 1 cut(s) 524
SspMI CTAG 4 cut(s) 126, 192, 515, 577
StyI CCWWGG 1 cut(s) 285
TaqI TCGA 1 cut(s) 460
TasI AATT 8 cut(s) 18, 38, 60, 144, 335, 389, 450, 486
TfiI GAWTC 1 cut(s) 157
Tru1I TTAA 2 cut(s) 33, 426
Tru9I TTAA 2 cut(s) 33, 426
TseI GCWGC 3 cut(s) 275, 323, 563
TspDTI ATGAA 1 cut(s) 137
XagI CCTNNNNNAGG 1 cut(s) 289
XapI RAATTY 4 cut(s) 18, 38, 144, 450
XspI CTAG 4 cut(s) 126, 192, 515, 577
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.